Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Topics - gsgs

Pages: [1] 2 3 ... 6
1
actual epidemic charts / US-Counties
« on: July 29, 2021, 03:49:16 am »
update 2021-07-20
990 US-Counties with population > 50000
sorted by incidence
http://magictour.free.fr/coun0720.nam

Code: [Select]
7-d-incidence per 1M
County-Code
population
County-name
06499,29213,00055928,Taney County,MO
05023,29097,00121328,Jasper County,MO
04932,29043,00088595,Christian County,MO
04665,29077,00293086,Greene County,MO
04599,29051,00076745,Cole County,MO
03729,12089,00088625,Nassau County,FL
03434,05069,00066824,Jefferson County,AR
03433,12031,00957755,Duval County,FL
03404,05045,00126007,Faulkner County,AR
03322,29145,00058236,Newton County,MO
03269,05145,00078753,White County,AR
03256,29021,00087364,Buchanan County,MO
03227,05119,00391911,Pulaski County,AR
03205,05125,00122437,Saline County,AR
03178,05085,00073309,Lonoke County,AR
03161,22105,00134758,Tangipahoa Parish,LA
03047,22063,00140789,Livingston Parish,LA
03022,22057,00097614,Lafourche Parish,LA
02964,17001,00065435,Adams County,IL
02890,22089,00053100,St. Charles Parish,LA
02880,53025,00097733,Grant County,WA
02842,05051,00099386,Garland County,AR
02801,22103,00260419,St. Tammany Parish,LA
02670,29169,00052607,Pulaski County,MO
02663,28049,00231840,Hinds County,MS
02649,22005,00126604,Ascension Parish,LA
02549,22045,00069830,Iberia Parish,LA
02522,56021,00099500,Laramie County,WY
02499,12019,00219252,Clay County,FL
02406,12005,00174705,Bay County,FL
02346,01097,00413210,Mobile County,AL
02343,29019,00180463,Boone County,MO
02295,13039,00054666,Camden County,GA
02220,05031,00110332,Craighead County,AR
02215,01003,00223234,Baldwin County,AL
02168,01031,00052342,Coffee County,AL
02159,12109,00264672,St. Johns County,FL
02154,22109,00110461,Terrebonne Parish,LA
02106,12097,00375751,Osceola County,FL
02086,12086,02716940,Miami-Dade County,FL
02024,32003,02266715,Clark County,NV
02017,29095,00703011,Jackson County,MO

00762,06037,10039107,Los Angeles County,CA
00231,17031,05150233,Cook County,IL
00472,48201,04713325,Harris County,TX
00923,04013,04485414,Maricopa County,AZ
00728,06073,03338330,San Diego County,CA
00433,06059,03175692,Orange County,CA
02086,12086,02716940,Miami-Dade County,FL
00565,48113,02635516,Dallas County,TX
00442,36047,02559903,Kings County,NY
00514,06065,02470546,Riverside County,CA
02024,32003,02266715,Clark County,NV
00367,36081,02253858,Queens County,NY
00381,53033,02252782,King County,WA
00525,06071,02180085,San Bernardino County,CA
00890,48439,02102515,Tarrant County,TX
00785,48029,02003554,Bexar County,TX
01527,12011,01952778,Broward County,FL
00355,06085,01927852,Santa Clara County,CA





http://magictour.free.fr/us-0720.GIF

2
vaccine / effectivity
« on: June 15, 2021, 01:34:24 am »
Code: [Select]
effectivity in England   1,2 doses

             symp  hosp
BNT-alpha,  47,94  83,95   68,12
AZ--alpha,  49,74  76,86   52,47

BNT-delta,  36,88  94,96   90,66   78
AZ--delta,  30,67  71,92   59,75   65

            40,81  78,92   65,50   71




symp-BNT-alpha,47,94
symp-AZ--alpha,49,74

hosp-BNT-alpha,83,95
hosp-AZ--alpha,76,86

symp-BNT-delta,36,88
symp-AZ--delta,30,67

hosp-BNT-delta,94,96
hosp-AZ--delta,71,92



efficacy

       symp   hosp   death   death|symp

BNT   ,87,95  --,--   
BNT   ,--,90  --,--  --,97   44,--
AZ-   ,--,87         80,--   55,--

BNT>80,       --,93



----------------------------------------------------
PHE-v23.pdf
alpha,symp, 50,88
delta,symp, 33,81

             infe   symp  trans  hosp   death
BNT-alpha,  62,80  62,87  47,--  80,92  77,97
AZ--alpha,  65,--  62,77  42,--  80,--  77,--
----------------------------------------------------
England
BNT-alpha,         47,94         83,95
AZ--alpha,         49,74         76,86

BNT-delta,         36,88         94,96
AZ--delta,         30,67         71,92
----------------------------------------------------
Michigan
10880-0dose,825-1dose,129-2dose

hosp   seve
40,90  -03,16
----------------------------------------------------
Qatar
            infe    seve
BNT-alpha, --,89    --,97
BNT-351  , --,75    --,97
------------------------------------------------






alpha=B.1.1.7  (Kent)
delta=B.1.617.2 (India)
beta?=B.1.351 (South Africa)
gamma?=P.1 (Brazil)

3
actual epidemic charts / India
« on: April 17, 2021, 09:58:21 pm »
India updates : https://www.mohfw.gov.in/
Maharashtra dashboard : https://www.covid19maharashtragov.in/mh-covid/dashboard
-----------------------------------------

Maharashtra:3343951 ; 3407245 ; 3458996 ; 3519208 ; 3578160 ; 3639855 ;
3703584,3770707,3839338 , 3898262 , 3960359 , 4094840 , 4228836 , 4343727
4410085,4473394,4539553,4665754

63294,51751,60212,58952,61695,63729,67123,68631
58924(26.6%),62097(23.4%),134481(24.3%),133996(23.8%)
114891(22.4%),66358(23.5%),63329(23.2%),66159(23.0%)
126201(21.8%)
tests,23854185,24075811,24341736,--,24895986,25460008,
25972018,26254737,26527862,26816075,27395288
-----------------------------------------------------


Code: [Select]
daily B.1.617 at cog_uk 0405-0417:
48,--,67,69,69,76,76,
79,79,90,98,140,160,171,
187,---,226,---,---,---,---,
---,441,505,562,---,688,730

Code: [Select]
daily E484Q at cog_UK 0322-0417 :
+50%/w --> more than B.1.1.7 in 15 weeks
064,---,079,086,---,---,---,
088,---,094,098,098,---,106,
109,---,128,130,---,138,138,
142,143,154,163,171,180,184
187,---,203,---,---,---,---,
---,276,298,304,---,322,332

Code: [Select]
daily L452R at cog_UK 0322-0416 :
217,---.263,288,---,---,---,
291,---,340,348,350,---,366,
369,---,452,458,---,487,487,
497,505,536,561,582,607,618
645,---,702,---,---,---,---,
---,981,1052,1115,----,1257,1303

weekly L452R+E484Q : 4,5,14,16,21,34,44,75,51,02
weekly B.1.617 : 4,5,14,18,22,51,99,233,271,13
weekly P.1 : 2,1,3,4,6,10,8,2,11,12,19,14,0
weekly B.1.351 : 08,23,36,59,31,21,29,21,31,38,38,63,90,68,73,61,38,00
weekly B.1.525 : 5,8,15,14,12,16,21,50,55,47,48,26,26,14,21,17,0
weekly B.1.1.318 : 1,4,2,11,6,6,22,14,8,24,14,12,6,10,1
weekly B.1.1.7 : 2407,9870,12943,13300,19156,11687,14101,16452,16136,
14061,16547,16111,17087,12485,8034,7119,4533,114
updated 2021-05-02 , until week 70
-----------------------

B.1.617 / B.1.1.7 : 001,004,012,033,060,114


Code: [Select]
weeks 61,..,69 ; updated on 04-29
B.1.617  ,02,05,14,18,22,51,100,225,125
B.1.351  ,29,38,38,63,90,68,71,56,28
C.36     ,03,15,16,11,09,11,16,24,14
B.1.525  ,43,55,47,48,26,26,14,21,05
P.1      ,04,06,10,08,02,11,12,17,11
B.1.     ,36,39,51,25,27,14,14,18,08
B.1.1.   ,20,25,24,04,12,05,08,08,04
B.1.36.  ,07,04,14,07,02,01,02,07,00
A        ,14,11,08,19,37,14,17,08,03
B.1.1.318,08,24,18,11,28,14,13,06,05
B.1.177  ,167,84,66,30,28,4,11,05,00
B.1.177. ,100,43,25,11,12,4,00,01,00
B.1.36.31,02,08,25,14,05,04,01,00,01
B.1.36   ,06,11,11,07,02,01,00,00,01
B.1.1.7  ,15995,14048,16510,16109,17085,12480,7921,6925,2363

617/117  ,001,004,008,011,013,041,126,325,529, 13.2, 33.1, 82.7, 206.8



{no updates at cog-UK 2021-04-22-2021-04-26}


4
genetics / PRRA
« on: April 13, 2021, 02:22:47 am »
PRRA [nucleotides CTCCTCGGCGGG or TCCTCGGCGGGC, depending how you align ]
is the amino-acid-furin cleavage site ("FCS") inserted into SARS2 at the S1-S2 border in the spike protein.
It is not seen in the similar bat or pangolin viruses, so ir was speculated that it was
inserted in a lab , as done in similar experiments on IBV=infectious bronchitis virus,
 a coronavirus in birds, for which they are trying to create chicken-vaccines.

there are 2 such FCS in some coronaviruses :

Code: [Select]
CTCCTCGGCGGG = insertion
TCTCCTCGGCGGGCACGT , SARS2  , spike , 2038-2055
  S  P  R  R  A  R
AAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTC , SARS2,spike,2431-2469
  K  P  S  K  R  S  F  I  E  D  L  L  F
AGTCCTAGAAGGCGTTCTTTTATTGAAGACCTTCTATTT , IBV  ,spike,2056-2094,AY761141
  S  P  R  R  R  S  F  I  E  D  L  L  F 

AGTCCTAGAAGGCG
 CTCCTCGGCGGG
 x----x-xx--x


https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5413309/
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6832359/pdf/viruses-11-00972.pdf



5
genetics / table/overview of new variants
« on: March 28, 2021, 11:46:29 pm »

at cog-uk :

Code: [Select]
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K
--------------------------------------------------------------------------------------------------
0202,224821, 42108, 132,  0,  36,73752, 876,3723,764,  1,  0,  0,  0,21,238
0214,257783, 67110, 197, 20,  36,77610, 880,3805,777,  1,  0,  0,  0,33,384
0228,297806,101496, 256, 44,  37,79650, 885,3845,783,  1, 17,  0,  5,42,532
0312,322718,124919, 295, 47,  37,80336, 880,3859,787,  1, 54,  1, 14,51,661
0327,358209,157497, 363, 51,  41,80721, 882,3881,791,  1,174,  6, 33,56,985
-----------------------------------------------------------------------------------------------------------
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K



at GISAID :

Code: [Select]
----------------P.1  -----------------------------
00003,00009 , 00000,00009 , 00034,02220 , 00087,02136 , 00181,03633 , Italy
00000,00000 , 00000,00000 , 00017,01697 , 00018,00934 , 00051,01672 , Belgium
00030,00115 , 00044,00101 , 00195,00399 , 00039,00269 , 00099,00351 , Brazil
00001,02564 , 00002,02406 , 00007,30072 , 00013,18305 , 00027,33146 , United States Of America
00000,00000 , 00000,00000 , 00014,01818 , 00003,01640 , 00004,01034 , Switzerland
00000,00000 , 00003,00082 , 00005,01724 , 00001,01365 , 00005,02909 , France
00000,00000 , 00002,00074 , 00002,02238 , 00000,00952 , 00008,02160 , Netherlands
00000,00000 , 00000,00000 , 00009,00073 , 00004,00006 , 00009,00034 , Colombia
00000,00000 , 00000,00000 , 00001,00132 , 00000,00101 , 00002,01101 , Mexico
00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , Faroe Islands
00004,00004 , 00000,00002 , 00002,00037 , 00000,02089 , 00000,00021 , Japan
00000,00000 , 00000,00000 , 00001,00588 , 00000,00431 , 00004,02185 , Spain
00000,00000 , 00000,00000 , 00000,00000 , 00006,03614 , 00001,01474 , Sweden
00000,00000 , 00000,00000 , 00000,00000 , 00001,00030 , 00001,00068 , Australia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00003,00025 , New Zealand
00000,00000 , 00000,00000 , 00002,02603 , 00002,20869 , 00018,33844 , United Kingdom
00000,00000 , 00000,00000 , 00002,00007 , 00003,00633 , 00002,00006 , Portugal
00000,00000 , 00000,00000 , 00001,00383 , 00005,01485 , 00002,00604 , Ireland
00000,00000 , 00000,00000 , 00000,00000 , 00014,06508 , 00019,10631 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00155 , Chile
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00603 , Norway
00000,00000 , 00000,00000 , 00000,00000 , 00002,00018 , 00000,00054 , Romania
00001,00001 , 00000,00000 , 00000,00172 , 00000,00146 , 00000,00322 , South Korea
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00843 , Slovenia
00000,00000 , 00001,00001 , 00000,00000 , 00022,00167 , 00000,00000 , Peru
00000,00000 , 00000,00000 , 00002,00452 , 00000,00885 , 00001,00778 , Turkey
00040,02694 , 00052,02675 , 00294,44615 , 00220,62583 , 00445,97653 , all
--------------------------------------------------------------------------------
        1.5 ,         1.9 ,         0.7 ,         0.4 ,         0.5 , all
       3877 ,        3108 ,        2239 ,        2904 .        3555 , all-Brazil
       0201          0209          0301          0312          0326 , date



from https://cov-lineages.org/global_report_P.1.html


Code: [Select]
---------------B.1.351l--------------------------------------------------------
00007,00007 , 00030,00038 , 00009,00011 , 00000,00000 , 00007,00007 , Botswana
00000,00000 , 00002,00018 , 00035,00620 , 00024,00885 , 00028,00778 , Turkey
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00002,03063 , 00006,06078 , 00014,36159 , 00030,19511 , 00095,33718 , United States Of America
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00519,00891 , 00216,00317 , 00303,00384 , 00048,00060 , 00336,00390 , South Africa
00003,06443 , 00004,06313 , 00003,04497 , 00002,02402 , 00000,00000 , Denmark
00094,51301 , 00038,26746 , 00053,37892 , 00029,22208 , 00090,35908 , United Kingdom
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00007,00068 , 00020,00024 , 00269,00427 , 00051,00137 , 00006,00015 , Mayotte
00009,00321 , 00001,00382 , 00000,00944 , 00009,01518 , 00004,00620 , Ireland
00000,00000 , 00001,00385 , 00001,00344 , 00000,00032 , 00000,00278 , Canada
00019,00052 , 00022,00031 , 00000,00000 , 00017,00027 , 00000,00000 , Mozambique
00000,00000 , 00001,00003 , 00000,00000 , 00000,00000 , 00000,00000 , Democratic Republic Of The Congo
00008,00392 , 00008,00054 , 00004,00064 , 00003,00056 , 00008,00080 , Australia
00000,00000 , 00000,00000 , 00001,00027 , 00012,03455 , 00000,00027 , Japan
00001,00009 , 00000,00000 , 00003,00257 , 00000,00147 , 00001,00335 , South Korea
00000,00000 , 00000,00000 , 00003,00048 , 00000,00035 , 00001,00004 , Thailand
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00002,00006 , 00004,00079 , 00000,00003 , 00000,00000 , 00000,00000 , Kenya
00005,00063 , 00000,00000 , 00000,00001 , 00000,00000 , 00000,00000 , United Arab Emirates
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00001,00041 , 00000,00534 , 00001,00056 , 00008,01161 , 00002,00007 , Portugal
00000,00000 , 00031,00033 , 00000,00000 , 00000,00000 , 00000,00000 , Zambia
00007,00048 , 00000,00000 , 00012,00054 , 00000,00010 , 00001,00035 , New Zealand
00000,00000 , 00000,00000 , 00000,00000 , 00002,00195 , 00004,00277 , Croatia
00000,00000 , 00000,00000 , 00001,00050 , 00005,00021 , 00007,00031 , Singapore
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00000,00000 , 00000,00000 , 00001,00023 , 00000,00000 , 00010,00068 , Rwanda
00000,00000 , 00000,00000 , 00001,00001 , 00001,00006 , 00000,00000 , Costa Rica
00000,00000 , 00007,00392 , 00009,00441 , 00000,00000 , 00036,01794 , Israel
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00063 , Aruba
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00005 , Sri Lanka
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00001,00003 , 00000,00000 , Brunei
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , Guadeloupe
00000,00000 , 00001,00078 , 00003,00017 , 00000,00000 , 00000,00065 , Ghana
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
00000,00000 , 00000,00000 , 00000,00000 , 00001,00015 , 00000,00000 , Cameroon
00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , 00000,00000 , Reunion
00000,00000 , 00000,00000 , 00000,00000 , 00195,00264 , 00004,00017 , Zimbabwe
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00002 , Russia
00000,00000 , 00001,00009 , 00000,00004 , 00000,00000 , 00000,00000 , Bangladesh
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00020,00021 , Eswatini
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00042 , China
00000,00000 , 00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , Panama
00000,00000 , 00002,00048 , 00000,00000 , 00000,00000 , 00000,00000 , Luxembourg
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00014,00015 , Lesotho
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00004,00018 , Malaysia
00750,69594 , 00485,46120 , 01066,98949 , 01013,82284 , 01488,108170, all
        1.1 ,         1.1 ,         1.1 ,         1.2 ,         1.4
       3362 ,        5872 ,        7741 ,       11678 ,       10706 
00086,13762 , 00116,11858 , 00613,22549 , 00646,35548 , 00822,34478 , Europe
       6249 ,        9782 ,       27185 ,       18173 ,       23841
-------------------------------------------------------------------------------
       0201          0214          0301          0312          0326



Code: [Select]
-------------------B.1.1.7 ---------------------------------
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
--------------------------------------------------------------------------------------

Germany,2021-03-01,142,1544
Germany,2021-03-08,4424,14533
Germany,2021-03-13,7389,20150
Germany,2021-03-21,10109,25376
Germany,2021-03-26,10115,25410

2021-03-01, 142/ 1544=09%
2021-03-08,4282/12989=33%
2021-03-13,2965/ 5587=53%
2021-03-29,2726/ 5260=52%



8
actual epidemic charts / measures
« on: January 09, 2021, 09:43:05 pm »
(incomplete)  list of measures in Europe since October




------------------------------------------------
Oct05,
new restrictions in Paris for two weeks
bars in Paris and suburbs closed starting Oct06
Restaurants : strict health protocols.
events < 1000 no alcohol >22:00
Public student, wedding, festive gathering forbidden.
Dance halls, game rooms, gyms and swimming pools closed
fairs, shows, and parks banned.
sricter guidelines for nursing home visits
------------------------------------------------
Denmark measures since mid-Sept :
restaurants,cafes,pubs close at 22:00
and masks are required there.
no gatherings >50 ,
homeoffice when possible,
avoid bus,train at main traffic hours
cases are declining since Sep27
up again since Oct18
----------------------------------------------
Since 2020/09/21 in Austria
private Feiern, Freizeitgestaltung, Gastronomie Märkte Messen
all private groups, except funerals, except dwellings : <10 instead <50
events : <100
masks on markets, exhibitions,gastro even outdoors
closed since 01:00
cases were plateauing in Austria since Sep21, up again since Sep28

Vienna measures : https://coronavirus.wien.gv.at/site/...tliches-leben/
since Sep27 Vienna surprisingly does better than Rest-Austria
Austria, Oct19, <7 on private meetings indoors and 13 outdoors
including weddings,clubs,birthday,gym
------------------------------------------
Montreal on 2020/10/08 released a breakdown
most have occurred in restaurants, bars, gyms and hotels.
------------------------------------------
Germany on 2020/10/07 detailed list, where people are infected
https://www.rki.de/DE/Content/Infekt...ublicationFile
mostly in dwellings
restaurants,bus,train : very rare
------------Oct07--------------------------------
Brussels closes all bars,cafes,restaurants
--------------------------------------------------------
Cataluna-Canovelles,Granollers,Franqueses, Aug25-Sep24
meetings<10 public and private, religious,bars,restaurants <50%
indoors and outdoors
cultural,recr.,sports special rules, <50%
cases are plateauing since Jul20, half of Madrid, deaths 1/3 of Spain
(why did it stop going up in July ? there must be other reasons)
Jul17 , Barcelona+Lleida, nightlife , masks required
https://web.gencat.cat/en/activem/re...als/catalunya/
https://portaljuridic.gencat.cat/ca/...ts/pjur_CoV-2/
----------------edit 2020/10/12---------------------------------------------
Quebec. The "red zone" limited closure strategy (close bars, restos, gyms,
restrict private gatherings, masks indoors in high schools) has knocked
R down from 1.4 two weeks ago to 0.9 today.
many clusters in Montreal are work-related.
Tele-work can prevent it
-----------------edit Oct14------------------
Netherlands partial lockdown since Oct14: Masks in public , asked to stay home
gatherings <5, no alcohol eve; bars, restaurants, cafes only takeout.
NL, bars restaurants closed no alcohol >20:00 , <3 private guests per day,
buses trains only if really necessary. Mask-rules (so far they had none).
Oct01 : After months of debate, NL issues 'urgent advice' for masks in public spaces
cases peak on Oct29
----Nov04
Netherlands, public buildings closed no foreign travel
----Nov19,
theaters museums,cinemas,libraries may re-open
bars,pubs,restaurants,cafes stay closed
3 (instead of 2) private guests per day allowed
---------------------edit Oct15-------------------------------------------------------
Czech builds field-hospitals
---------------------------------------------
curfew from 9pm-6am in Paris,St.Etienne,Lille,Lyon,Toulouse,Rouen
Grenoble,Montpellier,Marseille effective from 00:00 Saturday. Oct17
France bans all private parties at public venues, including weddings,
https://www.themayor.eu/en/france-en...rgency-tonight
https://www.connexionfrance.com/Fren...tions-answered
Oct17 , 19M , curfew , 21-06
no restrictions on public transport
€135fine , 12000 police officers
Bars closed , restaurants until 21:00.
IdF,Rouen,Lille,St.Etienne,Lyon,Grenoble,Toulouse, Montpellier,Marseille
----edit 1102 --- seems to be working ! cases down
especially in those 15 cities, but also elsewhere
but software bug, 60000 more cases since Oct28
http://magictour.free.fr/frci58b.GIF
-------------------------------------------------------
Oct16 , Lebanon closes bars, night clubs
------------------------------------------
Ontario, Sep.26 , bars restaurants, alcohol
week before : gatherings, events
screening business
"we can still prevent a staggering second wave in our city.”
Oct.16, York-region in modified stage 2 next week
------------------------------------------
Oct 17 The UK's new three-tier lockdown strategy won't stop the spread
according to former head of the WHO Professor Anthony Costello.
cases plateauing since Oct24
------------------------------------
Oct 19, lockdown in Berchtesgaden, Bavaria

=========================================
in Czechia Schools, bars, restaurants are closed,
public gatherings <7. Masks indoors
Full lockdown in two weeks.
--------------------------------------------------------------
Oct19
in Belgium bars cafes and restaurants close for 4 weeks,
curfew from 0-5, no alcohol > 8 pm. masks recommended
schools also closed (I think)
cases (MA3m) peak on Oct27 , full lockdown on Nov02
-------------------------------------------------
no gathering in London and 7 other ciies. bars, pubs and restaurants closed > 10 pm
“circuit breaker” , shutdown in Wales Oct23 , NI closed schools
--------------------------------------------------
Spain Oct09 , Madrid and 9 others in emergency. only essential travel,
reducing hotel and restaurant capacity, curfew >11 pm, gatherings <7
Catalonia closed bars and restaurants. Oct15 for 15d
------------------------------------------------------
Ireland lockdown:Oct21, only essential businesses asked to stay home.
Ireland is moving to level 5 from midnight on Wednesday, 21 October
cases peaked Oct19, 2 days before the lockdown
-----------------------------------------------------
Austria, gatherings <7 indoors <13 outdoors, local lockdown.
-------------------------------------------------------
Italy masks local 9 pm curfews restaurants )
-----------------------------------------------------------
Germany curfews, border checks, gatherings, local lockdown.
--------------------------------------------------
Greece masks
------------------------------------
Sweden encouraged to work from home.
-----------------------------------------------
2020/10/21 Radio Prague Int. @RadioPragueFr
New health measures in #Czechia from 10/22:
closure of all "non-essential" shops except food stores, pharmacies
and drugstores
Czech health secretary expects peak around Nov11
------------------------------------------
France , 15 departments under curfew from Oct25
---------------------------------------
Quebec, Oct01,no guests at home,
cases are plateauing
----------------------------------------------------
Oct23
Slovakia and Slovenia announce partial lockdowns
------------------------------
spanish government officials fail to agree on curfew measures
as health minister says epidemic is "out of control"
------------------------------------
France , the 9 p.m. curfew will be expanded to affect 46M people
----------------------------------------------------
Ireland,since Oct21: level5,lockdown {cases are going down since Oct19}
"we already have the strongest measures in Europe, but"
shops closed
Meet indoors only with people from same household
outdoors only <5km except work,school
schools and Kitas stay open
work from home, if possible
Oct 15 , budget , government members tested
5-level-plan
https://www.msn.com/en-ie/news/coron...ic/ar-BB194dlK
Oct15, Donegal, Monaghan and Cavan goto Level 4
---------------------------------------------------
Wales, lockdown since Oct30
--------------------------------------------------------
Bulgaria Oct 21
Oct 27 no entertainment , restrictions for bars etc.
cases plateauing since Nov05
------------------------------------------------------
Croatia, Oct 26
close events, gatherings<50,30,15 ; no alcohol>00:00, masks
https://www.thedubrovniktimes.com/ne...across-croatia
cases plateauing since Oct29 ... up again since Nov18
------------------------------------------------------
Northern Ireland {cases stable since Oct07}
lockdown on Oct.16, schools closed since Oct19
-------------------------------------
Germany since Nov02 :
only members from 2 household and max 10 people may meet in public
recreational and sports events cancelled
Bars,restaurants,clubs,discos,pubs, non-essential services closed. Take-away services allowed
Canteens stay open.
Financial support of $12B for companies that are affected
No Tourists
Asked to avoid private traveling
schools and shops stay open, only 1 customer per 10 squaremeters
Asked to work from home if possible
Churches stay open, but some measures are required
no curfew afaics
Bavaria orders contact reduction also for private rooms
(how to control ?)
Nov26:extended until Dec20 , plus private meetings<6,<3households
---------------------------------------------------
Oct29 , Macron announces nationwide lockdown, schools and work will continue
stay at home, except school, work, essential travel
Travel between regions prohibited
until 5000 cases/d
-------------------------------------------------
Oct31 ,
Belgium lockdown:
- All non-essential stores and some other businesses will close
- Bars and restaurants remain closed
- Working from home is mandatory, where possible
- People are still allowed to leave their home, but no visitors at home
- Measures will last at least 6 weeks
peak at Oct26, 5 daysl before the lockdown
----------------------------
Nov01 , UK nationwide lockdown
--------------------------------------
Oct29
measures in Switzerland
<11 friends+family
<50 events
<16 gatherings,sports
distance learning mandatory at > highschool
bars+ : <5 per table , sit for eat/drink
keep records , closed at 2300
nightclubs closed
masks in school , working indoors, bars+,shops,busy zones
Cantonal measures
no curfew, no travel restrictions, increased testing
cases down since ca. Nov05
-----------------------------------------
Oct15
Austria has ordered a full, three-week lockdown
shops (except food,drugs) and schools closed,
leave the home only for a good reason
---------------------------------------------
Nov11 , Sweden imposes partial lockdown on bars and restaurants ...
Nov20 , no alcohole in pubs after 22PM, closure 1/2hour earlier
------------------------------
Nov19 , Catalonia plans to open bars and restaurants at 30%
until five in the afternoon from Monday
The Government wants to carry out a de-escalation in four phases
that will have, at least, a duration of 15 days each
----------------------------------------------
Nov30 , Turkey announces weekend lockdown and 9 p.m. curfew on weekdays
Dec08,Bavaria, curfew in Hotspots , pupils change-lessons
Dec07 , Austria , reductions
Dec07 , Denmark is planning a partial lockdown in cities
Dec08 , Geneve opens restaurans
Dec08 , , Sachsen (SN) closes schools, most commerce
Dec08 , Bavaria in some days curfew21h , Thuringia maybe
Dec16 , hard lockdown in Germany and Netherlands
Dec15 , Italy increases measures (chart is down, looks good)
Dec17 , Germany-Saxony curfew in hotspots planned
Dec17, Denmark orders lockdown
Dec27,Czech lockdown #3


9
2021/03/02 : wikipedia has a good table : https://en.wikipedia.org/wiki/Lineage_B.1.1.7

variant charts by country :
https://covariants.org/per-country

genbank :  https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/virus?SeqType_s=Nucleotide&VirusLineage_ss=SARS-CoV-2,%20taxid:2697049
UK-cog : https://www.cogconsortium.uk/tools-analysis/public-data-analysis-2/
Germany : https://civnb.info/sequences/
Denmark : https://www.covid19genomics.dk/statistics   (Jan15)

Brazil : https://github.com/CADDE-CENTRE/Novel-SARS-CoV-2-P1-Lineage-in-Brazil
sequences no longer available (? they claim it's there, but I couldn't find it - edit: found ir here:),
https://github.com/CADDE-CENTRE/Novel-SARS-CoV-2-P1-Lineage-in-Brazil/blob/main/virological_post/CADDE_B.1.1.28_P1.fas
here is a nice overview:
https://cov-lineages.org/global_report_P.1.html
https://cov-lineages.org/global_report_B.1.351.html
https://cov-lineages.org/global_report_B.1.1.7.html
https://cov-lineages.org/global_report_B.1.525.html
https://cov-lineages.org/global_report_B.1.617.2.html   {old, not updated}







RKI : https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/Virologische_Basisdaten.html


genbank old : https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/virus?VirusLineage_ss=Severe%20acute%20respiratory%20syndrome%20coronavirus%202,%20taxid:2697049&SeqType_s=Nucleotide
UK , old  : https://www.cogconsortium.uk/data/  {no longer available 2021/02/26)


checking for the new strains B.1.351 and B.1.1.7 = VUI202012/01 = VOC2020

prevalence in UK :
2020/12/24 : http://magictour.free.fr/b117a.GIF
2020/12/31 : http://magictour.free.fr/s2ua5spa.GIF
2011/01/09 : http://magictour.free.fr/s2ukc-sp.GIF


2020/12/08 , genbank=5/44708 , UK=1203(1050)/131631
2020/12/15 , DE=0/747 , UK=1289/133960
2020/12/17 , DE=0/764 , UK=141600 new strain-names
2020/12/20 , UK=2100/146416
DE,genbank,UK,RKI , 3rdcov(F157L,614D),B.1.351(South Africa),B.1.1.7,all
2020/12/21 , 0,0,0,834 , 0,0,0,45416 , 03,01,3042,150173 , 02,01,0958,3757
2020/12/22 , 0,0,0,834 , 0,0,0,45416 , 03,01,3063,150399 , 00,00,0021,0226
2020/12/23 , 0,0,0,831 , 0,0,0,45416 , 03,01,3094,151499 , 00,00,0031,1100 ,RKI:0/1742
2020/12/24 , 0,0,0,831 , 0,0,0,45660 , 06,01,3478,153115 , 03,00,0384,1616
2020/12/25 , 0,0,0,831 , 0,0,?,45690 , 06,01,3786,154728 , 00,00,0308,1613
2020/12/26 , 0,0,0,831 , 0,0,?,45690 , 07,01,4171,156089 , 01,00,0385,1362
2020/12/27 , 0,0,0,831 , 0,0,?,45802 , 08,01,4599,157340 , 01,00,0428,1251
2020/12/28 , 0,0,0,831 , 0,0,0,46123 , 08,01,4637,157550 , 00,00,0038,0210
2020/12/29 , 0,0,0,831 , 0,0,0,46123 , 09,02,4722,157828 , 01,01,0085,0278
2020/12/30 , 0,0,0,915 , 0,0,?,47112 , 09,02,4745,158072 , 00,00,0023,0248
2020/12/31 , 0,0,0,914 , 0,0,2,47316 , 09,02,4745,158072 , 00,00,0000,0000
2021/01/01 , ?,0,?,916 , 0,0,3,47364 , 12,06,5478,160174 , 03,04,0733,2102
2021/01/02 , ?,0,?,916 , 0,0,?,47375 , 12,09,5579,160683 , 00,03,0101,0509
2021/01/03 , ?,0,?,916 , 0,0,?,47375 , 12,10,5598,160953 , 00,01,0019,0270
2021/01/04 , ?,0,?,916 , 0,0,?,47405 , 20,19,7145,164105 , 08,09,0547,3152
2021/01/05 , ?,0,?,916 , 0,0,?.47405 , 20,19,7145,164105 , 00,00,0000,0000
2021/01/06 , ?,0,?,916 , 0,0,?,47405 ,       7145,19,0,0,57678,667,3171,675,0,0
2021/01/07 , ?,0,?,916 , 0,0,?,47996 , 32,29,9425,170346 , 12,10,2280,6241
2021/01/08 , ?,0,?,916 , 0,0,?,48034 , 32,29,9425,170346 , 00,00,0000,0000
2021/01/09 , ?,0,?,916 , 0,?,?,48038 , 32,29,9425,170346 , 00,00,0000,0000
2021/01/10 , ?,0,?,916 , 0,?,?,48063 , 32,29,9425,170346 , 00,00,0000,0000
2021/01/11 , ?,0,?,916 , 0,0,12,48451 ,   13620,36,0,0,64210,703,3386,703,0,0
2021/01/12 , 0,0,3,960,48602,179932  ,  13620,36,0,0,64210,703,3386,703,0,0
2021/01/13 , 0,0,3,960,49010,179932,24(cadde,Brazil,B.1.1.28 )
2021/01/14,960,49124,179932,24
2021/01/15 , 0,1,5,1042 , 49807 . 179932 , 24
2021/01/16 , 1042,50006,179932,24
2021/01/17 , 1042,50008,179932,24 ,
2021/01/18 , 1042,50326,179932,24
2021/01/19 , 0,1,8,1126 , 50886 , 179932 , 24
2021/01/20 , 1129,51594,179932,24
2021/01/21 , 1129 , 52058 , 179932 , 24
2021/01/22 , 1129 , 52636 , 179932 , 24
2021/01/23 , 1129 , 52969 . 179932 , 24
2021/01/24 , 1210 , 52969 , 179932 , 24
2021/01/25 , 1272 , 53630 , 179932 , 24
2021/01/26 , 1272 , 54758 , 179932 , 24   (PHE:214159)
2021/01/27 , 1272 , 56592 , 179932 , 24 ,
2021/01/28 , 1274 , 57355 , 179932 , 24
2021/01/29 , 1274 , 57693 , 179932 , 24
2021/01/30 , 1274 , 57706 , 179932 , 24
2021/01/31 , 1274 , 57806 , 179932 , 24
2021/02/01 , 1356 , 57806 , 179932 , 24
2021/02/02 , 1397 , 59644 , 224820 , 24  {format-change at cog-uk,}
2021/02/03 , 1397 , 60084 , 224820 , 24  , 42108,132,0,36,73752,876,3723,764,1,0
2021/02/04 , 1397 , 60084*, 224820 , 24
2021/02/05 , 1397 , 61835 , 229120 , 24
2021/02/06 , 1397 , 61835 , 229120 , 24
2021/02/09 , 1397 , 62467 , 242926 , 24   , { 60543,170,129,0,81227,656,4136,839,1,26 }
2021/02/10 , 1397 , 62827 , 242926*, 24 , 55405,156,0,36,76299,878,3780,772,1,0,10
2021/02/11 , 1397 , 63956 , 242926 , 24
2021/02/12 , 1397 , 65743 , 249523 , 24
2021/02/13 , 1397 , 65745 , 254045 , 24
2021/02/14 , 1397 , 66036 , 257782 , 24
2021/02/15 , 1397 , 66044 , 257782 , 24
2021/02/16 , 1397 ,
2021/02/17 , 1397 , 66781 , 267131 , 24    , 75194,205,30,36,78074,880,3817,778,1,0
2021/02/18 , 1397 , 66785 , 271789 , 24    , 79138,218,31,36,78354,888,3821,779,1,0
2021/02/19 , 1397 , 66785 , 271789 , 24
2021/02/20 , 1397 , 66785 , 271789 , 24
2021/02/21 , 1397 , 66785 , 271789 , 24
2021/02/22 , 1397 , 76163 , 271789 , 24    ,  big genbank update, all from USA
2021/02/22 , 1397 , 79179 , 271789 , 24    , 
2021/02/25 , 1397 , 80086 , 271789 , 24
2021/03/01 , 1397 , 84277 , 297806 , 24    , 101496,256,44,37,79650,885,3845,783,1,17
2021/03/06 , 1397 , 91705 , 313258 , 24    , 113272,282,48,38,80487,890,3866,789,1,34,1
2021/03/10 , 1397 , 98768 , 313652 , 24    ,  116531,278,47,37,80204,880,3856,787,1,43,1
2021/03/12 , 1397, 103388 , 322717 , 24   ,  124917,295,47,37,80336,880,3859,787,1,54,1
2021/03/17 , 1397, 107850 , 332354 , 24   ,  133622,308,47,38,80494,880,3864,788,1,77,2  ; B.1.525 to 77

2021/04/22 , 1397 , 242752 , 387173 , 24 ,  suddenly there are 242752 sequences at genbank !
--------------------------------------
first B.1.1.7 at genbank : MW422255,MW422256,MW423686
San Diego, USA , Italy
Italy,12mut., no deletions !
https://www.ncbi.nlm.nih.gov/nuccore/MW422255

-------------------------------------------
https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/virus?VirusLineage_ss=Severe%20acute%20respiratory%20syndrome%20coronavirus%202,%20taxid:2697049&SeqType_s=Nucleotide
https://www.cogconsortium.uk/data/
https://civnb.info/sequences/

---------------------------------------------------
weekly % of B.1.1.7 in Denmark week 46 - 04 : redoubles every 8 days
0.3,0.0,0.2,0.2,0.4,0.8,2.1,2.3,4.0,7.5,12.8,19.1
Germany, week 4, B.1.1.7 = 5.8%
--------------------------------------------------------
ONS, Jan05

ttps://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/conditionsanddiseases/adhocs/12722estimatesofcovid19casesto02januaryforenglandregionsofenglandandbycasescompatiblewiththenewvariant
--------------------------------------------------------------------------
2021/02/01  Cologne reports 9% B.1.1.7 and 5% B.1.351


Code: [Select]
2020/12/23 , 151499,03094,001,00,00,51701,628,3000,652,0,0
2020/12/30 , 158072,04745,002,00,00,55287,661,3122,663,0,0
2021/01/06 , 164104,07145,019,00,00,57678,667,3171,675,0,0
2021/01/11 , 179931,13620,036,00,00,64210,703,3386,703,0,0
2021/02/03 , 224820,42108,132,00,36,73752,876,3723,764,1,0
2021/02/10 , 242925,55405,156,00,36,76299,878,3780,772,1,0
2021/02/17 , 267131,75194,205,30,36,78074,880,3817,778,1,0
------------------------------------------------------------------------------------
          A        ,           B,    C,  D, E, F, G,  H,  I,  J,  ,  L,M

all,
A , B.1.1.7,SE-England
B , B.1.351,South Africa
C , A.23,Uganda
D , B.1.1.28,Brazil-Manaos
E , B.1.177,Spain-Aragon
F , B.1.1.70,Wales
G , B.1.258 , Ireland ?
H , B.1.221 , Belgium
I , B.1.375 , USA - S-drop-out
J , B.1.525 ,


10
actual epidemic charts / UK , London , new variant
« on: January 01, 2021, 01:03:14 am »
actual London-chart ; http://magictour.free.fr/lond0127.GIF


deaths :  https://www.england.nhs.uk/statistics/statistical-work-areas/covid-19-daily-deaths/
weekly hospitalisations by region : 2020-12-31
https://www.england.nhs.uk/statistics/statistical-work-areas/covid-19-hospital-activity/
https://covid.joinzoe.com/data


https://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/conditionsanddiseases/bulletins/coronaviruscovid19infectionsurveypilot/latest#regional-analysis


London :
https://data.london.gov.uk/dataset/coronavirus--covid-19--deaths
https://data.london.gov.uk/download/coronavirus--covid-19--cases/151e497c-a16e-414e-9e03-9e428f555ae9/phe_cases_london_boroughs.csv
http://sonorouschocolate.com/covid19/index.php?title=LondonIndicators


---------------Ireland-------------------------------------------------------
https://www.gov.ie/en/news/7e0924-latest-updates-on-covid-19-coronavirus/#the-latest-news-as-of-715pm-on-thursday-7-january
https://www.gov.ie/en/collection/4b505-slides-from-the-nphet-press-briefings/
Jan07 : http://magictour.free.fr/irel0107.pdf
https://www.hpsc.ie/a-z/respiratory/coronavirus/novelcoronavirus/casesinireland/epidemiologyofcovid-19inireland/COVID19%20Daily%20infographic.pdf
-----------------------------------------------------------------------------



https://coronavirus.data.gov.uk/details/cases
2020/12/31 , cases last 7d , cases per M , total deaths, deaths per M


Code: [Select]

  138, 603,  377, 1649,Aberdeen City
  102, 390,  346, 1325,Aberdeenshire
   30, 467,  237, 3686,Adur
  103,1054,  196, 2005,Allerdale
  171,1334,  422, 3293,Amber Valley
   65, 559,  110,  947,Angus
  130, 906,  339, 2362,Antrim and Newtownabbey
   76, 470,  204, 1261,Ards and North Down
   52, 606,   44,  512,Argyll and Bute
  139, 643,  586, 2710,Armagh City Banbridge and Craigavon
   75, 467,  561, 3490,Arun
  168,1313,  352, 2752,Ashfield
  198,1523, 1012, 7783,Ashford
  133, 654, 1056, 5196,Aylesbury Vale
  123,1336,  368, 3998,Babergh
  245,1151, 2229,10469,Barking and Dagenham
  409,1033, 3152, 7962,Barnet
  560,2268,  519, 2102,Barnsley
  114,1700,   68, 1014,Barrow-in-Furness
  290,1549, 1908,10192,Basildon
  149, 844,  487, 2758,Basingstoke and Deane
  163,1388,  260, 2214,Bassetlaw
   81, 419,  317, 1640,Bath and North East Somerset
  254,1466, 1067, 6157,Bedford
  294, 856,  691, 2011,Belfast
  271,1091, 2656,10697,Bexley
 1594,1396, 3929, 3441,Birmingham
  109,1074,  254, 2502,Blaby
  246,1643,  552, 3687,Blackburn with Darwen
  292,2094,  252, 1807,Blackpool
   97,1204,  170, 2110,Bolsover
  526,1829,  497, 1728,Bolton
  141,2009,  201, 2864,Boston
  270, 683,  984, 2489,Bournemouth Christchurch and Poole
   79, 645,  717, 5851,Bracknell Forest
  769,1425,  948, 1756,Bradford
  149, 976, 1316, 8624,Braintree
  111, 793,  371, 2651,Breckland
  442,1340, 2356, 7144,Brent
  131,1701, 1010,13113,Brentwood
  154, 529, 1023, 3517,Brighton and Hove
  259, 559,  887, 1914,Bristol City of
  100, 765,  426, 3257,Broadland
  300, 903, 2926, 8804,Bromley
  156,1562,  308, 3084,Bromsgrove
   94, 966, 1095,11256,Broxbourne
  156,1368,  211, 1850,Broxtowe
  393, 722, 2822, 5188,Buckinghamshire
  174,1957,  443, 4982,Burnley
  382,2000,  450, 2356,Bury
  211, 998,  372, 1759,Calderdale
   48, 385,  390, 3125,Cambridge
  372, 569, 1669, 2554,Cambridgeshire
  142, 526, 1398, 5177,Camden
  153,1518,  322, 3196,Cannock Chase
  227,1372,  900, 5442,Canterbury
  138,1270,  439, 4039,Carlisle
  154,1704, 1024,11330,Castle Point
  113, 780,  313, 2161,Causeway Coast and Glens
  315,1091, 1420, 4919,Central Bedfordshire
  163, 877,  385, 2072,Charnwood
  173, 970, 1587, 8896,Chelmsford
  135,1161,  178, 1530,Cheltenham
   87, 578,  692, 4598,Cherwell
  512,1333,  940, 2447,Cheshire East
  525,1530,  934, 2722,Cheshire West and Chester
   97, 925,  160, 1525,Chesterfield
   63, 520,  282, 2328,Chichester
   83, 864,  376, 3915,Chiltern
  171,1447,  270, 2284,Chorley
  358, 682,  750, 1429,City of Edinburgh
   46, 893,   41,  795,Clackmannanshire
  159, 817,  806, 4140,Colchester
    1,  37,    2,   75,Comhairle nan Eilean Siar
   82,1203,   62,  909,Copeland
   78,1080,  148, 2049,Corby
  189, 331,  724, 1266,Cornwall and Isles of Scilly
   95,1057,  191, 2125,Cotswold
  893,1685, 1378, 2600,County Durham
  300, 807,  951, 2560,Coventry
   64,1120,   81, 1418,Craven
   86, 765,  607, 5400,Crawley
  467,1208, 3206, 8290,Croydon
  644,1288, 1187, 2374,Cumbria
  134, 866,  736, 4756,Dacorum
  180,1685,  263, 2462,Darlington
  137,1217, 1046, 9289,Dartford
   91,1059,  251, 2920,Daventry
  363,1411,  681, 2647,Derby
   70, 968,  112, 1549,Derbyshire Dales
 1035,1289, 1657, 2064,Derbyshire
   94, 621,  492, 3252,Derry City and Strabane
  378, 471, 1120, 1396,Devon
  621,1991,  691, 2216,Doncaster
  181, 478,  523, 1382,Dorset
  206,1744,  641, 5426,Dover
  441,1371,  980, 3047,Dudley
   69, 464,  115,  773,Dumfries and Galloway
  155,1038,  280, 1875,Dundee City
  334, 977, 2327, 6808,Ealing
  119, 975,  236, 1934,East Ayrshire
   42, 467,  223, 2482,East Cambridgeshire
   96, 656,  224, 1531,East Devon
  133,1224,  142, 1307,East Dunbartonshire
   72, 589,  350, 2862,East Hampshire
  109, 728,  885, 5910,East Hertfordshire
  291,2053,  160, 1129,East Lindsey
   71, 663,  122, 1139,East Lothian
 5900,1220,12064,  240,East Midlands
  133,1407,  234, 2475,East Northamptonshire
 6237,1000,35072, 5624,East of England
  111,1162,  174, 1821,East Renfrewshire
  500,1466,  601, 1762,East Riding of Yorkshire
  250,2088,  422, 3524,East Staffordshire
  256,1026,  477, 1912,East Suffolk
  495, 888, 3146, 5646,East Sussex
   76, 733,  537, 5176,Eastbourne
   81, 606,  343, 2568,Eastleigh
   55,1033,  258, 4845,Eden
  119, 870,  817, 5972,Elmbridge
  295, 884, 3497,10477,Enfield
  207,1572, 1765,13403,Epping Forest
   91,1129,  539, 6685,Epsom and Ewell
  164,1422,  193, 1673,Erewash
 1789,1201,12766, 8572,Essex
   61, 464,  194, 1476,Exeter
  112, 696,  163, 1013,Falkirk
  106, 912,  353, 3037,Fareham
  105,1031,  204, 2003,Fenland
   48, 409,  322, 2743,Fermanagh and Omagh
  217, 581,  429, 1148,Fife
  249,2204,  704, 6230,Folkestone and Hythe
   63, 726,  206, 2374,Forest of Dean
  184,2278,  123, 1523,Fylde
  315,1559,  539, 2668,Gateshead
  156,1323,  297, 2519,Gedling
  754,1191, 1084, 1712,Glasgow City
  135,1045,  390, 3020,Gloucester
  630, 989, 1403, 2202,Gloucestershire
   77, 908,  190, 2240,Gosport
  148,1384, 1008, 9426,Gravesham
   77, 775,  226, 2275,Great Yarmouth
  222, 771, 2200, 7640,Greenwich
   80, 537,  707, 4745,Guildford
  218, 750, 2245, 7719,Hackney and City of London
  164,1267,  271, 2094,Halton
   76, 830,  271, 2959,Hambleton
  136, 735, 1100, 5941,Hammersmith and Fulham
 1076, 778, 4355, 3150,Hampshire
   83, 885,  235, 2505,Harborough
  205, 763, 2305, 8580,Haringey
  100,1149,  885,10165,Harlow
  134, 833,  207, 1287,Harrogate
  339,1350, 2000, 7963,Harrow
   45, 464,  348, 3585,Hart
  164,1751,  395, 4217,Hartlepool
   58, 626,  884, 9540,Hastings
  142,1125,  621, 4920,Havant
  491,1892, 2947,11354,Havering
  140, 726,  349, 1810,Herefordshire County of
 1166, 980, 7833, 6585,Hertfordshire
  173,1649,  969, 9236,Hertsmere
  139,1500,  130, 1403,High Peak
   33, 140,  134,  568,Highland
  301, 981, 2510, 8179,Hillingdon
  121,1070,  219, 1936,Hinckley and Bosworth
  117, 814,  402, 2796,Horsham
  269, 991, 2121, 7811,Hounslow
  128, 719,  413, 2321,Huntingdonshire
  123,1518,  227, 2801,Hyndburn
   72, 925,  127, 1632,Inverclyde
  156,1139,  431, 3148,Ipswich
   91, 642,  336, 2370,Isle of Wight
  133, 549, 1527, 6298,Islington
  113, 724,  775, 4964,Kensington and Chelsea
 2120,1340,10512, 6647,Kent
  111,1091,  226, 2221,Kettering
  170,1123,  412, 2722,King's Lynn and West Norfolk
  398,1532,  613, 2360,Kingston upon Hull City of
  168, 946, 1100, 6197,Kingston upon Thames
  589,1339,  715, 1626,Kirklees
  237,1571,  283, 1876,Knowsley
  264, 810, 2361, 7242,Lambeth
 1940,1590, 3058, 2507,Lancashire
  153,1048,  339, 2321,Lancaster
  923,1164, 1524, 1921,Leeds
  429,1211, 1064, 3004,Leicester
  755,1069, 1627, 2304,Leicestershire
   97, 939,  437, 4232,Lewes
  270, 883, 2272, 7429,Lewisham
  175,1671,  294, 2807,Lichfield
  116,1168,  358, 3605,Lincoln
 1012,1329, 1950, 2562,Lincolnshire
   99, 678,  279, 1911,Lisburn and Castlereagh
  783,1572, 1032, 2072,Liverpool
 8410, 938,72325, 8070,London
  272,1277, 1119, 5252,Luton
  169, 984, 1252, 7286,Maidstone
   43, 662,  477, 7347,Maldon
   54, 686,  101, 1283,Malvern Hills
  709,1282, 1059, 1916,Manchester
  118,1079,  270, 2470,Mansfield
  442,1587, 2527, 9072,Medway
   65,1269,  129, 2519,Melton
   76, 658,  220, 1903,Mendip
  233,1128, 1733, 8390,Merton
  113, 811,  431, 3095,Mid and East Antrim
   38, 462,  122, 1482,Mid Devon
   96, 924,  199, 1915,Mid Suffolk
  151,1000,  593, 3927,Mid Sussex
  112, 754,  385, 2592,Mid Ulster
  214,1518,  317, 2249,Middlesbrough
  121,1309,  115, 1244,Midlothian
  216, 802, 2194, 8142,Milton Keynes
  106,1215,  386, 4424,Mole Valley
   14, 146,   53,  553,Moray
    1,  37,    2,   75,Na h-Eileanan Siar
  120, 666,  304, 1688,New Forest
  120, 980,  259, 2116,Newark and Sherwood
  318,1050,  425, 1403,Newcastle upon Tyne
  229,1769,  282, 2179,Newcastle-under-Lyme
  329, 932, 3471, 9829,Newham
   85, 469,  400, 2205,Newry Mourne and Down
  666, 734, 2536, 2794,Norfolk
  149,1106,  210, 1559,North Ayrshire
   54, 556,  129, 1328,North Devon
  156,1538,  194, 1912,North East Derbyshire
  207,1297,  161, 1009,North East Lincolnshire
 4067,1523, 5855, 2193,North East
   96, 719,  473, 3541,North Hertfordshire
  127,1086,  324, 2771,North Kesteven
  372,1090,  596, 1746,North Lanarkshire
  221,1283,  263, 1526,North Lincolnshire
   76, 725,  226, 2156,North Norfolk
  196, 911,  459, 2134,North Somerset
  238,1145,  352, 1693,North Tyneside
  108,1655,  127, 1946,North Warwickshire
  117,1129,  204, 1969,North West Leicestershire
11847,1614,16462, 2242,North West
  589, 953, 1184, 1916,North Yorkshire
  327,1456,  913, 4065,Northampton
  898,1192, 2332, 3096,Northamptonshire
  426,1321,  662, 2053,Northumberland
   44, 313,  446, 3173,Norwich
  386,1160,  748, 2247,Nottingham
  996,1203, 1930, 2330,Nottinghamshire
  204,1571,  362, 2787,Nuneaton and Bedworth
   97,1701,  201, 3525,Oadby and Wigston
  454,1915,  412, 1738,Oldham
    2,  90,    1,   45,Orkney Islands
   68, 446,  520, 3411,Oxford
  385, 557, 2309, 3338,Oxfordshire
  160,1737,  371, 4028,Pendle
  102, 671,  188, 1237,Perth and Kinross
  171, 845,  792, 3916,Peterborough
  124, 473,  490, 1870,Plymouth
  142, 661,  950, 4421,Portsmouth
  226,1579,  294, 2054,Preston
  163,1008,  749, 4630,Reading
  407,1333, 3444,11284,Redbridge
  188,1371,  175, 1276,Redcar and Cleveland
  109,1278,  186, 2182,Redditch
  195,1311,  855, 5748,Reigate and Banstead
  211,1178,  339, 1893,Renfrewshire
   84,1380,  200, 3285,Ribble Valley
  146, 737, 1233, 6227,Richmond upon Thames
   56,1042,  119, 2215,Richmondshire
  483,2172,  474, 2131,Rochdale
  121,1385,  855, 9786,Rochford
   90,1259,  158, 2210,Rossendale
  137,1426,  609, 6338,Rother
  555,2091,  529, 1993,Rotherham
   83, 762,  329, 3020,Rugby
   74, 828,  409, 4574,Runnymede
  115, 965,  281, 2358,Rushcliffe
   79, 835,  700, 7400,Rushmoor
   26, 651,   75, 1878,Rutland
   45, 813,  101, 1824,Ryedale
  459,1773,  507, 1959,Salford
  587,1787, 1221, 3717,Sandwell
  150,1379,  236, 2170,Scarborough
   60, 519,  150, 1299,Scottish Borders
   80, 649,  390, 3166,Sedgemoor
  472,1708,  526, 1903,Sefton
   64, 706,  169, 1865,Selby
  111, 919,  813, 6733,Sevenoaks
  785,1342, 1018, 1741,Sheffield
    6, 262,   18,  785,Shetland Islands
  307, 950,  364, 1126,Shropshire
  135, 903, 1077, 7202,Slough
  332,1534,  592, 2736,Solihull
   60, 387,  396, 2553,Somerset West and Taunton
  306, 544, 1307, 2325,Somerset
  144,1279,  116, 1030,South Ayrshire
   65, 923,  529, 7510,South Bucks
   49, 308,  439, 2760,South Cambridgeshire
  141,1315,  276, 2573,South Derbyshire
 8131, 886,45205, 4924,South East
  228, 800,  526, 1845,South Gloucestershire
   19, 218,   93, 1069,South Hams
  112,1179,  181, 1905,South Holland
  123, 864,  453, 3181,South Kesteven
  152,1446,  164, 1561,South Lakeland
  410,1279,  552, 1722,South Lanarkshire
   88, 625,  429, 3045,South Norfolk
   76, 804,  343, 3630,South Northamptonshire
   89, 627,  466, 3280,South Oxfordshire
  133,1200,  188, 1697,South Ribble
   90, 535,  301, 1788,South Somerset
  141,1254,  347, 3086,South Staffordshire
  297,1967,  344, 2279,South Tyneside
 3392, 603,10248, 1822,South West
  148, 586,  875, 3465,Southampton
  252,1376, 1756, 9589,Southend-on-Sea
  184, 577, 2308, 7239,Southwark
   96, 961,  674, 6751,Spelthorne
  159,1071,  870, 5860,St Albans
  236,1307,  352, 1949,St. Helens
  218,1588,  362, 2637,Stafford
  179,1818,  216, 2194,Staffordshire Moorlands
 1459,1659, 2398, 2726,Staffordshire
   65, 740,  496, 5646,Stevenage
   64, 679,   80,  849,Stirling
  420,1431,  670, 2283,Stockport
  299,1515,  421, 2133,Stockton-on-Tees
  454,1771,  618, 2411,Stoke-on-Trent
  172,1322,  244, 1876,Stratford-on-Avon
  118, 984,  251, 2092,Stroud
  730, 959, 1916, 2517,Suffolk
  535,1927,  584, 2103,Sunderland
   70, 784,  469, 5252,Surrey Heath
 1125, 940, 6465, 5404,Surrey
  207,1003, 1675, 8117,Sutton
  250,1666, 1067, 7109,Swale
  137, 617,  617, 2777,Swindon
  511,2256,  405, 1788,Tameside
  114,1486,  153, 1995,Tamworth
   92,1044,  598, 6786,Tandridge
   49, 365,  173, 1289,Teignbridge
  130, 723,  262, 1457,Telford and Wrekin
  203,1385,  582, 3971,Tendring
  100, 793,  318, 2521,Test Valley
   84, 884,  187, 1968,Tewkesbury
  240,1691,  706, 4975,Thanet
  109,1168,  784, 8401,Three Rivers
  250,1434, 2198,12607,Thurrock
   83, 628,  828, 6265,Tonbridge and Malling
   97, 712,   85,  624,Torbay
   39, 571,   70, 1025,Torridge
  195, 600, 3138, 9663,Tower Hamlets
  324,1365,  598, 2519,Trafford
  102, 859,  535, 4506,Tunbridge Wells
   59, 646,  551, 6036,Uttlesford
   68, 500,  371, 2728,Vale of White Horse
  525,1507,  633, 1817,Wakefield
  482,1688,  899, 3149,Walsall
  278,1004, 2494, 9004,Waltham Forest
  235, 713, 2313, 7016,Wandsworth
  310,1476,  583, 2776,Warrington
  114, 793,  327, 2275,Warwick
  681,1178, 1389, 2403,Warwickshire
  131,1356,  845, 8749,Watford
  111, 879,  471, 3728,Waverley
  127, 786,  679, 4205,Wealden
   82,1029,  217, 2722,Wellingborough
   96, 780,  680, 5527,Welwyn Hatfield
  106, 669,  532, 3358,West Berkshire
   22, 394,  115, 2061,West Devon
  112,1259,  112, 1259,West Dunbartonshire
  192,1680,  251, 2196,West Lancashire
  102,1066,  273, 2854,West Lindsey
  194,1060,  155,  847,West Lothian
 7960,1341,16394, 2763,West Midlands
   73, 660,  260, 2350,West Oxfordshire
   99, 553,  441, 2463,West Suffolk
  589, 682, 3015, 3490,West Sussex
  162, 620, 1306, 4998,Westminster
  747,2273,  659, 2005,Wigan
  316, 632,  806, 1612,Wiltshire
  105, 841,  341, 2731,Winchester
  128, 845,  843, 5567,Windsor and Maidenhead
  471,1454,  761, 2349,Wirral
   91, 903,  540, 5358,Woking
  144, 842,  758, 4430,Wokingham
  386,1466, 1153, 4378,Wolverhampton
   73, 721,  191, 1887,Worcester
  667,1120, 1289, 2164,Worcestershire
   67, 606,  333, 3012,Worthing
  128, 989,  287, 2217,Wychavon
  112, 643,  861, 4941,Wycombe
  147,1451,  216, 2132,Wyre Forest
  250,2230,  194, 1731,Wyre
  154, 731,  562, 2668,York
 7607,1382,10333, 1878,Yorkshire and The Humber


11
genetics / spike-mutations
« on: December 22, 2020, 12:42:56 pm »
Code: [Select]

  29,  26,   1,C21575T,   L5F,               
 937, 435,  36,C21614T,  L18F,20A.EU1=B.1.177
   9,  10,   0,C21627T,  T22I,               
  31,  11,   0,A21631T,  Q23H,               
  41,  17,   7,C21637T,      ,               
   6,   7,   0,C21638T,  P26S,               
   2,   6,   0,C21727T,      ,               
  30,   6,   5,G21800T,  D80Y,               
   9,  10,   0,C21855T,  S98F,               
   0,   6,   0,C22000T,      ,               
   2,   6,   0,T22016A, W152R,               
  81,   6,   0,G22051T,      ,               
  15,   6,   8,A22053C, N164T,               
   7,   8,   3,C22075T,      ,               
  18,   7,   0,C22088T, L176F,               
   7,   9,   3,G22131T, R190M,               
  15,  19,   0,G22205C, D215H,               
  16,  11,   0,C22224T, S221L,               
1584, 908,  73,C22227T, A222V,20A.EU1=B.1.177
  13,  10,   0,C22329T, S256L,               
  58,  52,   3,G22346T, A262S,        B.1.177
  39,  39,   0,C22377T, P272L,               
  20,  13,   1,C22388T,      ,               
   0,  19,   0,C22432T,      ,               
  63,  47,   2,C22444T,      ,         B.1.36
   1,   8,   0,C22530T, T323I,               
   1,   7,   1,A22546G,      ,               
  36,  33,   3,C22879A, N439K,          B.1.5
   2,  13,   1,G22918T,      ,               
  43,  16,   0,G22992A, S477N,               
   6,  10,   0,T23042C, S494P,               
 423, 880,  12,A23063T, N501Y,        B.1.1.7
 406, 885,  14,C23271A, A570D,        B.1.1.7
  42,  25,   4,G23311C, E583D,               
   6,  19,   3,T23323C,      ,               
   9,   6,   0,G23401T, Q613H,               
2344,2015, 104,A23403G, D614G,               
 409, 889,  14,C23604A, P681H,        B.1.1.7
   1,   6,   0,G23608T,      ,               
  12,  10,   0,C23625T, A688V,               
  28,  24,   0,C23644T,      ,               
  11,  11,   0,C23679T, A706V,               
 407, 883,  14,C23709T, T716I,        B.1.1.7
   0,   6,   0,T23866C,      ,               
   5,  14,   1,G23873T, A771S,               
  21,  10,   0,T24088C,      ,               
  19,  35,   1,C24106T,      ,               
   1,   6,   0,C24130T,      ,               
   1,   6,   0,C24138A, T859N,               
   4,   9,   0,C24138T, T859I,               
 347, 235,  16,C24334T,      ,               
   7,  15,   0,C24378T, S939F,               
  32,   9,   0,C24382T,      ,               
 406, 885,  14,T24506G, S982A,        B.1.1.7
  11,   8,   0,G24620T,A1020S,               
  14,  10,   0,T24769C,      ,               
   3,   8,   0,G24781T,K1073N,               
  30,  19,   1,T24910C,      ,               
 406, 887,  14,G24914C,D1118H,        B.1.1.7
   1,   8,   1,T24979C,      ,               
   4,   6,   0,C25000T,      ,               
   2,   7,   0,G25049K,      ,               
  45,  71,   0,G25049T,D1163Y,        B.1.177
  46,  76,   0,G25062T,G1167V,        B.1.177
  12,  14,   0,C25096T,      ,               
   4,  14,   1,C25349A,P1263T,       
-----------------------------------------------------
2345,2027,0104,total genomes     
0049,0050,0051,week         



frequency of spike-mutations in 133277 full genomes
in week 50 from cogconsortium , 2020/12/22


831,45416,151499


checking for the new strain B.1.1.7 = VUI202012/01 = VOC2020

prevalence in UK : http://magictour.free.fr/b117a.GIF

2020/12/08 , genbank=5/44708 , UK=1203(1050)/131631
2020/12/15 , DE=0/747 , UK=1289/133960
2020/12/17 , DE=0/764 , UK=141600 new strain-names
2020/12/20 , UK=2100/146416
2020/12/21 , DE=0/834,UK=3042/150173
2020/12/22 , DE=834,genbank=,UK=3063/150399
2020/12/23 , DE=0/831,genbank=45416,UK=3094/151499,RKI:0/1742



I downloaded the 133277 aligned sequences from cogconsortium (3.9GB)
and processed/converted them into a better format :
http://magictour.free.fr/sars2uk8.7z (2MB)
this takes many hours each day for me , because of the big files.
Is someone else doing this ?

Can we coordinate, exchange the processed/improved data ?

-------------------------------------------

viruses with many spike-amino-acid mutations :

genbank, USA,CA : S13I,C136G,W152C,L452R
UK, B.1.1.7 , B.1.258 , B.1.37 , B.1.315 , B.1.177 ,  B.1.160 , B.1.5 ,  B.1.351 (SA)

file spisur.12a :  sequences with >=5? spike-amino-acid-mutations (2020/12/28)

Code: [Select]

    182,B.1.177.9
     55,B.1.177
     31,B.1.258.4
     25,B.1.1.37
     14,B.1.177.6
     11,B.1.177.17
      4,B.1.1
      3,B.1.160.7
      1,B.1.5.34
      1,B.1.351
      1,B.1.1.194


Code: [Select]

    329,D614G
    286,A222V
    222,A262S
    184,D80Y
    183,N164T

    127,E583D
     57,L5F
     46,L18F
     40,P272L
     32,G1219V
     31,V772I
     31,N439K
     31,L189F
     28,H655Y
     27,T95I
     25,D574Y
     18,V308L
     15,Q23H
     15,A1020S
     12,I1216V
     11,L176F
      8,N536S
      8,G446V
      8,D796H
      8,A520S
      7,G1167V
      7,D1163Y
      6,Q613H
      6,D215H
      5,S98F
      5,S477N
      5,R346K
      4,K1205N
      4,A1226V
      3,W152R
      3,T678I
      3,S884F
      3,S221L
      3,R21K
      3,P681L
      3,L244F
      3,G482S
      3,F329L
      3,A871S
      2,T716I
      2,S982A
      2,R190K
      2,Q677H
      2,Q675R
      2,Q218H
      2,P681H
      2,P384L
      2,N501Y
      2,L552F
      2,L1141F
      2,K1191N
      2,H146Y
      2,E484K
      2,E1150D
      2,D936Y
      2,D215Y
      2,D215V
      2,D138Y
      2,D1118H
      2,A845S
      2,A783T
      2,A771S
      2,A706V
      2,A688V
      2,A570D
      2,A522V
      2,A522S
      2,A1174V
      2,A1078S
      1,Y269C
      1,Y266C
      1,Y200C
      1,Y145N
      1,V687L
      1,V539I
      1,V445I
      1,V36L
      1,V367F
      1,V213A
      1,V1230A
      1,V1104L
      1,T768N
      1,T63N
      1,T51I
      1,T307N
      1,T22I
      1,T20I
      1,T19K
      1,S937L
      1,S813I
      1,S735A
      1,S691F
      1,S659L
      1,S50L
      1,S494P
      1,S151T
      1,S12F
      1,S1261F
      1,S1242I
      1,S1175P
      1,R765L
      1,R214L
      1,Q314K
      1,P9L
      1,P681R
      1,P561T
      1,P384S
      1,P1079S
      1,N925S
      1,N556Y
      1,N211T
      1,L822F
      1,L455F
      1,L216F
      1,L141F
      1,K444R
      1,K417N
      1,K1181I
      1,K1073N
      1,I468V
      1,I210T
      1,I1179V
      1,H146Q
      1,G482A
      1,G476F
      1,G181V
      1,G181A
      1,G142V
      1,G1124V
      1,F2L
      1,F157S
      1,F157L
      1,E484R
      1,E1182Q
      1,D80A
      1,D215G
      1,D1257Y
      1,D1153Y
      1,D1084Y
      1,A924V
      1,A924S
      1,A879V
      1,A846V
      1,A701V
      1,A668S
      1,A653V
      1,A647S
      1,A27S
      1,A243S
      1,A163V


12
nCoV - discussion / B.1.1.7 = vui-202012/1
« on: December 17, 2020, 10:48:12 pm »
https://flutrackers.com/forum/forum/europe-aj/europe-covid-19-sept-13-2020-may-31-2021/901351-england-new-variant-of-covid19-coronavirus-may-be-causing-faster-spread-in-some-areas-december-14-2020-wales-scotland-denmark






twitter-thread from @Chjulian , translated from Spanish :

 Update: Headlines announce the identification of a "new variant" of the coronavirus in the UK.
 It is not clear if the new variant is responsible for the increase in cases.
However, this variant is interesting. And here I tell you why 37 / n
@Chjulian
·
First, we need to understand that our immune system uses specialized mechanisms
to recognize and eliminate the virus, preventing its spread and ending disease.
The infectious period is the time in which we can transmit SARS-CoV-2 to another person

In the case of COVID19, the infectious period begins a couple of days before symptoms
develop and can last up to a couple of weeks (more details here https://bmjopen.bmj.com/content/10/8/e039856
). The disease is generally acute, short-lived bone 39 / n

An Immunocompetent individual has a normal
immune response. When our immune
system is weakened, we say it is immunosuppressed. Immunosuppressed individuals
may have persistent infections that last for longer periods of time (months!) 40 / n

Under these conditions, SARS-CoV-2 can accumulate many more mutations than we
would expect (in a single individual) and which could be transmitted if the transmission
is successful after a long time 41 / n

Remember that it is normal for viruses to mutate and SARS-CoV-2 accumulates
(on average) one or two mutations per month at the population level 42 / n
[##  1.43 per month , ua5m1.gif {gsgs} ]

The new variant (named B.1.1.7) has 17 mutations (woah!). And it is speculated that
it could have originated in an individual with a persistent infection (for example,
an immunosuppressed individual, but we have no information about it) 43 / n

It is important to mention that our immune system goes to the battlefield as quickly
 as possible to avoid an arms race at the molecular level, reducing the chances that
the virus will produce a mutation that allows it to evade our immune response 44 / n

If the hypothesis turns out to be true, it can have important consequences for treatment.
 A persistent infection accumulates diversity and depending on how we treat it, we may
or may not cause an arms race at the molecular level 45 / n

That is, to select mutations with unknown epidemiological potential. There is no need
 to be alarmed, I just want to show how we scientists must think and articulate our strategy
to face the battle in the short, medium and long term 46 / N

Nor can we say that a persistent infection in an immunosuppressed individual is a
greater problem than infections in immunocompetent individuals. Definitely the
evolutionary forces that "moderate" the evolution of the virus are different and ... 47 / n

... we hope that the origin of B.1.1.7 was somewhat unusual and had nothing to do
 with the increase in cases (studies continue). There is also a second hypothesis
(with less support) to explain why this variant has so many 48 / n mutations

Are you sure they remember minks? there is always the slim chance that SARS-CoV-2
will adapt to other mammals (By the way, there are no minks on farms in the UK),
but a prolonged epidemic ... 49 / n

... in the fauna around us it could result in new genetic variants that could (after a while)
jump to humans with various mutations. For this and other reasons, it is important to
evaluate what is happening at the level of the fauna around us 50 / n

t really amazes me how much we learn and the twists and turns a sprout can take! 51 / n

Fortunately, there is no evidence (to date) that this variant has an impact on the severity
of the disease or on the effectiveness of 52 / n vaccines.



13
actual epidemic charts / USA-deaths
« on: December 14, 2020, 01:35:49 am »
Code: [Select]
2453229, 2774641 ,04,All Cause
 2234697, 2550736 ,05,Natural Cause
   32960,   33776 ,06,Septicemia (A40-A41)
  518136,  512577 ,07,Malignant neoplasms (C00-C97)
   75070,   84086 ,08,Diabetes mellitus (E10-E14)
  103200,  111955 ,09,Alzheimer disease (G30)
   42979,   46919 ,10,Influenza and pneumonia (J09-J18)
  135074,  130283 ,11,Chronic lower respiratory diseases (J40-J47)
   37774,   38305 ,12,Other diseases of respiratory system (J00-J06,J30-J39,J67,J70-J98)
   44132,   44405 ,13,Nephritis, nephrotic syndrome and nephrosis (N00-N07,N17-N19,N25-N27)
   27040,   52927 ,14,Symptoms, signs and abnormal clinical and laboratory findings, not elsewhere classified (R00-R99)
  565959,  582547 ,15,Diseases of heart (I00-I09,I11,I13,I20-I51)
  128206,  134272 ,16,Cerebrovascular diseases (I60-I69)
       0,  236985 ,17,COVID-19 (U071, Multiple Cause of Death)
       0,  216748 ,18,COVID-19 (U071, Underlying Cause of Death)
----------------------------------------------------------------------
    2019,    2020 ,  weeks 1-45

14
genetics / release 240.0
« on: November 03, 2020, 01:19:51 am »
2020/11/03 , genbank release 240 , Oct.15 is available

https://ftp.ncbi.nlm.nih.gov/genbank/gbrel.txt

release 239 from Aug2020 had 39 virus files with 17491 MB and 3161686 sequences and 5824026918 Bases
   and 50462 coronavirus nucleotide sequences
release 240 from Oct2020 has 44 virus files with 18889 MB and 3223498 sequences and 6442230159 Bases
   and 68651 coronavirus nucleotide sequences 33844 of which are SARS2

Pages: [1] 2 3 ... 6