Show Posts

This section allows you to view all posts made by this member. Note that you can only see posts made in areas you currently have access to.


Messages - gsgs

Pages: [1] 2 3 ... 14
1
actual epidemic charts / Re: US-Counties
« on: July 29, 2021, 04:20:14 am »
update 2021-07-27
990 US-Counties with population > 50000
sorted by incidence
http://magictour.free.fr/coun0727.nam


Code: [Select]
A,14-d-incidence per M.population
B,County-code
C,incidence Jul-27
D,population
E,State
F,County-name

    A,    B,    C,       D, E,     F
---------------------------------------------------
07817,22105,11657,00134758,LA,Tangipahoa Parish
07169,29213,07616,00055928,MO,Taney County
06931,22005,10773,00126604,LA,Ascension Parish
06655,22063,10022,00140789,LA,Livingston Parish
06259,22057,08861,00097614,LA,Lafourche Parish
06245,12089,07447,00088625,FL,Nassau County
05671,12031,06708,00957755,FL,Duval County
05602,29051,05016,00076745,MO,Cole County
05109,29077,05175,00293086,MO,Greene County
05073,29043,05034,00088595,MO,Christian County
04990,22089,06553,00053100,LA,St. Charles Parish
04928,29097,04796,00121328,MO,Jasper County
04918,22103,06143,00260419,LA,St. Tammany Parish
04501,12005,05689,00174705,FL,Bay County
04449,22109,06318,00110461,LA,Terrebonne Parish
04358,22033,06440,00440059,LA,East Baton Rouge Parish
04344,12019,05418,00219252,FL,Clay County
04231,01097,05440,00413210,AL,Mobile County
04229,22099,06288,00053431,LA,St. Martin Parish
04212,05069,04713,00066824,AR,Jefferson County
04201,01003,05290,00223234,AL,Baldwin County
04106,05045,04523,00126007,AR,Faulkner County

01260,06037,01551,10039107,CA,Los Angeles County
00402,17031,00515,05150233,IL,Cook County
00799,48201,01125,04713325,TX,Harris County
01413,04013,01504,04485414,AZ,Maricopa County
01204,06073,01495,03338330,CA,San Diego County
00729,06059,00906,03175692,CA,Orange County
03322,12086,04080,02716940,FL,Miami-Dade County
00916,48113,01164,02635516,TX,Dallas County
00704,36047,00861,02559903,NY,Kings County
00914,06065,01169,02470546,CA,Riverside County
02362,32003,02481,02266715,NV,Clark County
00537,36081,00664,02253858,NY,Queens County
00539,53033,00652,02252782,WA,King County
00869,06071,01060,02180085,CA,San Bernardino County
01465,48439,01535,02102515,TX,Tarrant County
02007,48029,03024,02003554,TX,Bexar County
02530,12011,03100,01952778,FL,Broward County
00607,06085,00738,01927852,CA,Santa Clara County



by State : http://magictour.free.fr/US-0727.GIF

2
actual epidemic charts / US-Counties
« on: July 29, 2021, 03:49:16 am »
update 2021-07-20
990 US-Counties with population > 50000
sorted by incidence
http://magictour.free.fr/coun0720.nam

Code: [Select]
7-d-incidence per 1M
County-Code
population
County-name
06499,29213,00055928,Taney County,MO
05023,29097,00121328,Jasper County,MO
04932,29043,00088595,Christian County,MO
04665,29077,00293086,Greene County,MO
04599,29051,00076745,Cole County,MO
03729,12089,00088625,Nassau County,FL
03434,05069,00066824,Jefferson County,AR
03433,12031,00957755,Duval County,FL
03404,05045,00126007,Faulkner County,AR
03322,29145,00058236,Newton County,MO
03269,05145,00078753,White County,AR
03256,29021,00087364,Buchanan County,MO
03227,05119,00391911,Pulaski County,AR
03205,05125,00122437,Saline County,AR
03178,05085,00073309,Lonoke County,AR
03161,22105,00134758,Tangipahoa Parish,LA
03047,22063,00140789,Livingston Parish,LA
03022,22057,00097614,Lafourche Parish,LA
02964,17001,00065435,Adams County,IL
02890,22089,00053100,St. Charles Parish,LA
02880,53025,00097733,Grant County,WA
02842,05051,00099386,Garland County,AR
02801,22103,00260419,St. Tammany Parish,LA
02670,29169,00052607,Pulaski County,MO
02663,28049,00231840,Hinds County,MS
02649,22005,00126604,Ascension Parish,LA
02549,22045,00069830,Iberia Parish,LA
02522,56021,00099500,Laramie County,WY
02499,12019,00219252,Clay County,FL
02406,12005,00174705,Bay County,FL
02346,01097,00413210,Mobile County,AL
02343,29019,00180463,Boone County,MO
02295,13039,00054666,Camden County,GA
02220,05031,00110332,Craighead County,AR
02215,01003,00223234,Baldwin County,AL
02168,01031,00052342,Coffee County,AL
02159,12109,00264672,St. Johns County,FL
02154,22109,00110461,Terrebonne Parish,LA
02106,12097,00375751,Osceola County,FL
02086,12086,02716940,Miami-Dade County,FL
02024,32003,02266715,Clark County,NV
02017,29095,00703011,Jackson County,MO

00762,06037,10039107,Los Angeles County,CA
00231,17031,05150233,Cook County,IL
00472,48201,04713325,Harris County,TX
00923,04013,04485414,Maricopa County,AZ
00728,06073,03338330,San Diego County,CA
00433,06059,03175692,Orange County,CA
02086,12086,02716940,Miami-Dade County,FL
00565,48113,02635516,Dallas County,TX
00442,36047,02559903,Kings County,NY
00514,06065,02470546,Riverside County,CA
02024,32003,02266715,Clark County,NV
00367,36081,02253858,Queens County,NY
00381,53033,02252782,King County,WA
00525,06071,02180085,San Bernardino County,CA
00890,48439,02102515,Tarrant County,TX
00785,48029,02003554,Bexar County,TX
01527,12011,01952778,Broward County,FL
00355,06085,01927852,Santa Clara County,CA





http://magictour.free.fr/us-0720.GIF

3
nCoV - discussion / Re: Apr07 model UofWA
« on: June 27, 2021, 09:26:05 pm »
IHME death-predictions for 2021-06-28 and 2021-10-01 on 2021-06-28 :
USA,925751,949335
UK,152318,163383
GER,132000,133264
BRA,643700,761018
CHL,32285,44985
ISR,6860,6901
IND,1111110,1162831
IDN,152432,386181
RUS,852715,1003439
SA,156505,208921

4
weekly promille of B.1.617 in cog-UK-sequences by lab per 2021-06-15
Code: [Select]
oth-,000,003,011,033,046,089,270,432,611,795,837,000
HSLL,000,000,068,232,212,392,470,664,807,893,919,000
RAND,000,032,048,136,228,229,000,160,000,000,000,000
PHEC,000,015,061,083,217,291,380,379,691,795,878,000
MILK,001,004,026,086,160,273,416,602,766,892,899,000
ALDP,000,002,016,049,141,306,507,750,857,929,919,000
CAMC,021,041,081,046,000,000,000,000,000,000,000,000
NORT,000,049,008,020,030,023,089,222,455,650,710,000
LOND,000,000,000,103,117,299,547,672,746,892,895,000
QEUH,000,002,005,009,024,379,706,782,840,906,897,000
CAMB,000,000,041,393,136,331,360,440,968,000,914,000
all-,001,007,022,057,113,227,374,564,752,866,883,000

weekly numbers of all sequences by nation :
all-,2868,8746,7965,7998,7528,7055,7930,9994,13063,19521,4140
SCT,2060,1263,1204,1053,0990,1048,1356,1698,2531,3272,0005
WLS,0364,0351,0262,0205,0190,0162,0181,0175,0139,0272,0212
WLS,0142,0111,0091,0084,0014,0038,0099,0359,0206,0009,0000

weekly promille of B.1.617 by nation :
all,001,007,022,057,113,227,374,564,752,866,883
SCT,000,003,007,027,048,088,313,539,644,755,980
WLS,000,003,004,034,026,111,210,126,503,680,802
WLS,000,000,011,107,142,026,020,053,082,879,000


5
vaccine / effectivity
« on: June 15, 2021, 01:34:24 am »
Code: [Select]
effectivity in England   1,2 doses

             symp  hosp
BNT-alpha,  47,94  83,95   68,12
AZ--alpha,  49,74  76,86   52,47

BNT-delta,  36,88  94,96   90,66   78
AZ--delta,  30,67  71,92   59,75   65

            40,81  78,92   65,50   71




symp-BNT-alpha,47,94
symp-AZ--alpha,49,74

hosp-BNT-alpha,83,95
hosp-AZ--alpha,76,86

symp-BNT-delta,36,88
symp-AZ--delta,30,67

hosp-BNT-delta,94,96
hosp-AZ--delta,71,92



efficacy

       symp   hosp   death   death|symp

BNT   ,87,95  --,--   
BNT   ,--,90  --,--  --,97   44,--
AZ-   ,--,87         80,--   55,--

BNT>80,       --,93



----------------------------------------------------
PHE-v23.pdf
alpha,symp, 50,88
delta,symp, 33,81

             infe   symp  trans  hosp   death
BNT-alpha,  62,80  62,87  47,--  80,92  77,97
AZ--alpha,  65,--  62,77  42,--  80,--  77,--
----------------------------------------------------
England
BNT-alpha,         47,94         83,95
AZ--alpha,         49,74         76,86

BNT-delta,         36,88         94,96
AZ--delta,         30,67         71,92
----------------------------------------------------
Michigan
10880-0dose,825-1dose,129-2dose

hosp   seve
40,90  -03,16
----------------------------------------------------
Qatar
            infe    seve
BNT-alpha, --,89    --,97
BNT-351  , --,75    --,97
------------------------------------------------






alpha=B.1.1.7  (Kent)
delta=B.1.617.2 (India)
beta?=B.1.351 (South Africa)
gamma?=P.1 (Brazil)

7
actual epidemic charts / Re: UK , London , new variant
« on: May 29, 2021, 09:28:29 pm »
promille of B.1.617 in sequences at cog-UK by lab and week

Code: [Select]
oth-,000,003,011,035,047,092,282,454,497
HSLL,000,000,068,232,208,392,480,678,000
RAND,000,032,048,136,228,236,000,249,000
PHEC,000,015,061,081,220,291,367,385,713
MILK,001,004,027,085,160,272,420,590,000
ALDP,000,002,016,049,143,307,507,734,000
CAMC,020,041,077,046,000,000,000,000,000
NORT,000,049,008,020,026,028,090,218,476
LOND,000,000,000,103,117,324,579,672,709
QEUH,000,002,005,009,023,376,706,780,000
CAMB,000,000,041,393,136,331,450,440,968
all-,001,007,022,057,115,233,386,560,662



7-day-incidence in UK-regions

Code: [Select]
1927,2747,2831,3015,3210,3425,3846,4340,4298,4514,4524,4493,4340,4038,Bolton
1076,1176,1149,1316,1450,1603,1870,2151,2538,2806,3026,3140,3327,3554,Blackburn with Darwen
0860,1223,1229,1281,1270,1235,1420,1425,1673,1864,1939,2020,2083,1950,Bedford
0586,0900,0946,1006,1050,1099,1123,1226,1268,1335,1373,1401,1442,1459,Glasgow City
0356,0680,0754,0869,0942,1015,1183,1162,1089,1162,1131,1110,1110,1047,East Renfrewshire
0580,0673,0691,0707,0721,0737,0803,0887,0953,0994,1066,1087,1121,1096,Kirklees
0337,0506,0551,0607,0619,0619,0585,0607,0731,0765,0697,0843,0900,0956,Burnley
0357,0454,0530,0552,0573,0562,0508,0595,0757,0692,0811,0811,0822,0909,Midlothian
0879,0992,1064,1038,1077,1011,0939,0879,0859,0780,0806,0747,0714,0694,Derry City and Strabane
0773,1039,1083,1155,1212,1256,1364,1475,1574,1657,1708,1739,1762,1745,top9(0518)
      266,  44,  72,  57,  44, 108, 111,  99,  83,  51,  31,  23, -17,
---------------------------------------------------------------------
0515,0517,0518,0519,0520,0521,0522,0523,0524,0525,0526,0527,0528,0529,

0466,0446,0310,0252,0291,0349,0563,0854,1048,1261,1397,1610,1630,1513,Clackmannanshire
0196,0238,0210,0280,0294,0350,0406,0574,0630,0769,1133,1385,1665,2126,Rossendale
0395,0407,0395,0432,0457,0457,0518,0543,0568,0666,0777,0802,0913,1024,Hyndburn
0179,0201,0223,0262,0268,0279,0341,0402,0514,0570,0648,0776,0821,0972,Renfrewshire
0405,0470,0436,0447,0450,0443,0420,0517,0528,0593,0628,0662,0698,0785,Manchester
0221,0377,0377,0460,0460,0479,0561,0534,0497,0552,0635,0764,0782,0736,East Dunbartonshire
0418,0463,0457,0491,0497,0508,0497,0469,0550,0576,0587,0632,0630,0649,Leicester

0539,0401,0373,0344,0316,0275,0308,0340,0324,0292,0288,0296,0280,0259,Barnsley
0439,0419,0393,0391,0376,0383,0422,0443,0484,0517,0535,0576,0589,0597,Bradford
0194,0283,0293,0319,0382,0435,0461,0555,0571,0613,0644,0654,0660,0723,Bury
0393,0331,0369,0369,0374,0388,0445,0468,0482,0426,0482,0515,0492,0468,Calderdale
0305,0381,0389,0474,0474,0482,0474,0558,0558,0584,0567,0550,0567,0660,Chorley
0181,0154,0154,0154,0134,0141,0147,0161,0188,0254,0315,0429,0522,0623,Dundee City
1803,1135,0685,0555,0485,0407,0373,0364,0338,0295,0286,0251,0208,0208,Erewash
0414,0398,0362,0332,0352,0323,0355,0391,0433,0469,0492,0531,0551,0547,Hillingdon
0490,0567,0578,0593,0563,0512,0508,0475,0501,0516,0508,0538,0545,0527,Hounslow
0208,0237,0231,0287,0327,0304,0315,0366,0417,0423,0383,0394,0462,0513,Kingston upon Thames
0517,0488,0449,0430,0426,0414,0396,0386,0397,0387,0395,0388,0382,0366,Leeds
0314,0314,0296,0324,0361,0422,0418,0498,0512,0498,0479,0451,0422,0441,Luton
0488,0527,0449,0410,0332,0234,0176,0137,0137,0117,0137,0156,0176,0234,Melton
0350,0444,0465,0512,0532,0498,0505,0545,0532,0532,0545,0566,0579,0539,Mid Ulster
0518,0440,0418,0418,0397,0348,0319,0291,0291,0248,0220,0270,0270,0277,Middlesbrough
1002,0689,0584,0595,0480,0407,0365,0344,0240,0209,0146,0146,0177,0136,Moray
0458,0458,0491,0414,0391,0397,0397,0402,0380,0391,0469,0502,0502,0485,Newry Mourne and Down
0252,0267,0252,0282,0267,0304,0304,0349,0482,0438,0438,0468,0490,0557,North Ayrshire
0226,0317,0317,0356,0361,0423,0515,0510,0548,0524,0515,0563,0539,0438,North Tyneside
0358,0413,0445,0391,0402,0380,0423,0445,0521,0499,0478,0489,0554,0695,Pendle
0321,0293,0342,0377,0405,0440,0447,0489,0531,0503,0566,0573,0587,0699,Preston
0101,0081,0067,0081,0087,0074,0087,0101,0141,0188,0255,0303,0437,0558,Reigate and Banstead
0197,0148,0148,0131,0131,0164,0164,0214,0230,0246,0246,0296,0427,0608,Ribble Valley
0477,0432,0423,0427,0396,0396,0436,0436,0472,0459,0472,0522,0558,0625,Rochdale
0321,0255,0251,0247,0259,0255,0247,0274,0340,0325,0340,0406,0440,0556,Salford
0539,0416,0347,0311,0311,0279,0246,0224,0203,0199,0192,0177,0159,0134,Sefton
0695,0530,0497,0563,0475,0508,0475,0430,0441,0419,0364,0386,0298,0265,Selby
0463,0484,0495,0505,0547,0453,0410,0326,0358,0379,0368,0326,0368,0410,South Holland
0265,0387,0462,0471,0484,0459,0424,0434,0440,0468,0477,0462,0499,0555,South Lanarkshire
0312,0295,0303,0345,0371,0358,0417,0493,0560,0569,0543,0535,0552,0527,Trafford
0537,0413,0399,0359,0342,0284,0310,0319,0327,0345,0365,0370,0405,0422,Wakefield
0301,0377,0353,0323,0341,0338,0329,0341,0380,0420,0462,0472,0490,0575,Wigan
0109,0198,0237,0267,0286,0267,0375,0425,0484,0484,0514,0514,0563,0445,Worcester



----,0105,0097,0098,0097,0098,1000,0094,0086,----,0090,0093,0090,0087,Wales
----,0315,0332,0348,0357,0361,0367,0391,0412,----,0438,0450,0467,0492,Scotland
----,0352,0358,0346,0332,0323,0323,0324,0321,----,0332,0334,0323,0309,Northern Ireland
----,0230,0212,0210,0210,0205,0206,0213,0220,----,0231,0236,0241,0248,England
----,0391,0369,0355,0347,0340,0337,0344,0353,----,0368,0375,0376,0373,Yorkshire and the Humber
----,0166,0150,0151,0153,0143,0147,0152,0155,----,0159,0158,0162,0166,West Midlands
----,0116,0097,0094,0092,0086,0085,0082,0085,----,0091,0090,0091,0088,South West
----,0140,0123,0119,0119,0117,0116,0118,0120,----,0122,0125,0133,0144,South East
----,0377,0362,0372,0387,0390,0409,0448,0462,----,0505,0519,0537,0571,North West
----,0219,0203,0200,0195,0186,0197,0197,0199,----,0194,0196,0198,0191,North East
----,0207,0193,0194,0194,0189,0188,0192,0204,----,0215,0220,0227,0231,London
----,0197,0179,0178,0175,0165,0165,0169,0174,----,0179,0186,0190,0186,East of England
----------------------------------------------------------------------
0515,0517,0518,0519,0520,0521,0522,0523,0524,0525,0526,0527,0528,0529


19d,0315,0332,0348,0357,0361,0367,0391,0412,----,0438,0450,0467,0492,Scotland
            17,  16,  09,  04,  06,  24,  21,   ,  26,  12,  17,  25,
27d,0230,0212,0210,0210,0205,0206,0213,0220,----,0231,0236,0241,0248,England
                                01,  07,  07, --,  11,  05,  05,  07,
37d,0166,0150,0151,0153,0143,0147,0152,0155,----,0159,0158,0162,0166,West Midlands
                                04,  05,  03, --,  04,  -1,  04,  04
26d,0140,0123,0119,0119,0117,0116,0118,0120,----,0122,0125,0133,0144,South East
                                     02,  02, --,  02,  03,  08,  11,
17d,0377,0362,0372,0387,0390,0409,0448,0462,----,0505,0519,0537,0571,North West
                 10,  15,  03,  19,  29,  14,  -,  43,  14,  18,  34,
24d,0207,0193,0194,0194,0189,0188,0192,0204,----,0215,0220,0227,0231,London
                                     04,  12,  --,  11,  05,  07,  04




charts : http://magictour.free.fr/bolton.GIF

worldwide : http://magictour.free.fr/e-0528.GIF
increasing since 1-2 weeks in many countries in Asia,South America




8
actual epidemic charts / Re: UK , London , new variant
« on: May 23, 2021, 01:37:31 am »
promille B.1.617 by lab at cog_uk on 2021-05-22
for weeks 66-73
Code: [Select]
oth-,000,003,010,034,048,080,261,464
HSLL,000,000,068,232,208,392,358,000
RAND,000,032,048,136,228,236,000,000
PHEC,000,015,061,081,233,385,308,304
MILK,001,004,027,085,160,272,420,542
ALDP,000,002,016,049,142,308,469,000
CAMC,020,041,077,046,000,000,000,000
NORT,000,049,008,020,027,029,083,000
LOND,000,000,000,103,117,341,196,000
QEUH,000,002,005,008,023,359,701,000
CAMB,000,000,041,393,142,331,392,000
all-,001,007,022,057,116,238,364,344


7-day-incidence , from 380 UK-regions
Code: [Select]
1927,2747,2831,3015,3210,3425,3846,Bolton
1076,1176,1149,1316,1450,1603,1870,Blackburn with Darwen
0860,1223,1229,1281,1270,1235,1420,Bedford
0586,0900,0946,1006,1050,1099,1123,Glasgow City
0879,0992,1064,1038,1077,1011,0939,Derry City and Strabane
0356,0680,0754,0869,0942,1015,1183,East Renfrewshire
0580,0673,0691,0707,0721,0737,0803,Kirklees
0337,0506,0551,0607,0619,0619,0585,Burnley
0357,0454,0530,0552,0573,0562,0508,Midlothian
0773,1039,1083,1155,1212,1256,1364,top9(0518)
      266,  44,  72,  57,  44, 108
-----------------------------------
0515,0517,0518,0519,0520,0521,0522

0466,0446,0310,0252,0291,0349,0563,Clackmannanshire
0221,0377,0377,0460,0460,0479,0561,East Dunbartonshire
0395,0407,0395,0432,0457,0457,0518,Hyndburn
0226,0317,0317,0356,0361,0423,0515,North Tyneside

0490,0567,0578,0593,0563,0512,0508,Hounslow
0350,0444,0465,0512,0532,0498,0505,Mid Ulster
0517,0488,0449,0430,0426,0414,0396,Leeds
0539,0401,0373,0344,0316,0275,0308,Barnsley
1803,1135,0685,0555,0485,0407,0373,Erewash
0418,0463,0457,0491,0497,0508,0497,Leicester
0488,0527,0449,0410,0332,0234,0176,Melton
0518,0440,0418,0418,0397,0348,0319,Middlesbrough
1002,0689,0584,0595,0480,0407,0365,Moray
0539,0416,0347,0311,0311,0279,0246,Sefton
0695,0530,0497,0563,0475,0508,0475,Selby
0463,0484,0495,0505,0547,0453,0410,South Holland
0537,0413,0399,0359,0342,0284,0310,Wakefield




----,0105,0097,0098,0097,0098,1000,Wales
----,0315,0332,0348,0357,0361,0367,Scotland
----,0352,0358,0346,0332,0323,0323,Northern Ireland
----,0230,0212,0210,0210,0205,0206,England
----,0391,0369,0355,0347,0340,0337,Yorkshire and the Humber
----,0166,0150,0151,0153,0143,0147,West Midlands
----,0116,0097,0094,0092,0086,0085,South West
----,0140,0123,0119,0119,0117,0116,South East
----,0377,0362,0372,0387,0390,0409,North West
----,0219,0203,0200,0195,0186,0197,North East
----,0207,0193,0194,0194,0189,0188,London
----,0197,0179,0178,0175,0165,0165,East of England
-----------------------------------
0515,0517,0518,0519,0520,0521,0522,




5.3% per day , redoubles every 2 weeks currently
in average in the 9 hotspots

9
actual epidemic charts / Re: UK , London , new variant
« on: May 20, 2021, 12:39:48 pm »
1927,2747,2831,3015,3210,3425,Bolton
1076,1176,1149,1316,1450,1603,Blackburn with Darwen
0860,1223,1229,1281,1270,1235,Bedford
0586,0900,0946,1006,1050,1099,Glasgow City
0879,0992,1064,1038,1077,1011,Derry City and Strabane
0356,0680,0754,0869,0942,1015,East Renfrewshire
0580,0673,0691,0707,0721,0737,Kirklees
0337,0506,0551,0607,0619,0619,Burnley
0357,0454,0530,0552,0573,0562,Midlothian
0773,1039,1083,1155,1212,1256,top9(0518)
-----------------------------------
0515,0517,0518,0519,0520,0521,

0350,0444,0465,0512,0532,0498,Mid Ulster
0418,0463,0457,0491,0497,0508,Leicester

0539,0401,0373,0344,0316,0275,Barnsley
1803,1135,0685,0555,0485,0407,Erewash
0490,0567,0578,0593,0563,0512,Hounslow
0517,0488,0449,0430,0426,0414,Leeds
0488,0527,0449,0410,0332,0234,Melton
0518,0440,0418,0418,0397,0348,Middlesbrough
1002,0689,0584,0595,0480,0407,Moray
0539,0416,0347,0311,0311,0279,Sefton
0695,0530,0497,0563,0475,0508,Selby
0463,0484,0495,0505,0547,0453,South Holland
0537,0413,0399,0359,0342,0284,Wakefield




----,0105,0097,0098,0097,0098,Wales
----,0315,0332,0348,0357,0361,Scotland
----,0352,0358,0346,0332,0323,Northern Ireland
----,0230,0212,0210,0210,0205,England
----,0391,0369,0355,0347,0340,Yorkshire and the Humber
----,0166,0150,0151,0153,0143,West Midlands
----,0116,0097,0094,0092,0086,South West
----,0140,0123,0119,0119,0117,South East
----,0377,0362,0372,0387,0390,North West
----,0219,0203,0200,0195,0186,North East
----,0207,0193,0194,0194,0189,London
----,0197,0179,0178,0175,0165,East of England
-----------------------------------
0515,0517,0518,0519,0520,0521,




5.3% per day , redoubles every 2 weeks currently
in average in the 9 hotspots



10
genetics / Re: table/overview of new variants
« on: May 16, 2021, 04:09:32 am »
Code: [Select]
HSLL,000,000,068,231,199,406,000
RAND,000,031,047,135,227,240,000
PHEC,000,014,060,081,234,436,052
MILK,000,003,026,082,162,277,000
ALDP,000,002,016,043,142,272,000
CAMC,019,041,077,046,000,000,000
NORT,000,049,007,020,016,022,064
LOND,000,000,000,102,122,341,000
QEUH,000,002,004,008,021,320,000
oth-,000,002,010,038,046,073,155
---------------------------------
week  66, 67, 68, 69, 70, 71, 72


proportion in 0/00 of B.1.617.2 in sequences
at cog-UK in weeks 66-72 by lab (date : 2021-05-15)
(only the 9 labs with the typically most B.1.617)


11
actual epidemic charts / Re: India
« on: April 25, 2021, 02:07:47 am »
https://whitenewspaper.com/2021/04/24/nearly-60-of-samples-of-indian-variant-from-maha-find-scientists-health-news-et-healthworld/
2021-04-24
both Covaxin and Covishield are able to protect against the strain, reports Sumitra Deb Roy.

all: 15133  (during which time ?)
B.1.1.7 = 1195 (543Punjab, 124Delhi , 29Maha
B.1.617 = 728 (427Maha, 124WB, 75 Delhi , 53Mp)
B.1.351 = 29

----------------------------------------------------------------------------------
Mumbai, peek on 2021-04-04 = 11206 cases
now 5867 cases

---------------------------------------------------------------------

Code: [Select]
Laksha, 7026 ,  0 ,18271 ,  0
Delhi-, 4046 , 17 ,17766 ,160
Goa---, 4434 , 37 , 9560 ,101
Ladakh, 2937 ,  0 , 9554 , 21
Chhatt, 4179 , 32 , 8652 , 96
Mahara,10311 , 47 , 8367 , 58
Chandi, 7914 , 39 , 7579 , 37
Puduch, 3035 , 16 , 7056 , 40
Kerala, 3152 , 17 , 6680 ,  9
DadraN,  817 ,  0 , 4259 ,  3
Karnat, 1611 ,  8 , 4195 , 24
Uttara,  913 ,  5 , 4083 , 34
Haryan, 1587 ,  7 , 4056 , 18
Total#, 1769 ,  9 , 3101 , 19
Himach, 1409 , 15 , 2617 , 29
Gujara, 1132 ,  4 , 2394 , 24
Punjab, 3103 , 57 , 2365 , 34
Madhya,  916 ,  3 , 2182 , 12
Rajast,  501 ,  1 , 2105 ,  9
Andhra,  585 ,  2 , 2064 ,  6
Teleng,  732 ,  3 , 2032 ,  7
TamilN,  980 ,  5 , 2016 ,  8
UttarP,  304 ,  1 , 1938 ,  9
Jharkh,  452 ,  2 , 1853 , 21
JammuK,  837 ,  5 , 1785 ,  8
Sikkim,  321 ,  1 , 1357 ,  1
WestBe,  350 ,  1 , 1332 ,  5
Odisha,  235 ,  0 , 1299 ,  1
Andama,  380 ,  0 , 1190 , 10
Bihar-,  130 ,  0 , 1102 ,  4
Mizora,  149 ,  0 ,  733 ,  1
Meghal,   82 ,  1 ,  532 ,  2
Assam-,   66 ,  0 ,  517 ,  2
Arunac,   28 ,  0 ,  484 ,  0
Manipu,   86 ,  0 ,  313 ,  3
Nagala,   96 ,  0 ,  310 ,  1
Tripur,   75 ,  0 ,  229 ,  0

-------------------------------------

India , COVID 19 by state , per million population
cases- 2021/03/10 - 2021/04/10
deaths 2021/03/10 - 2021/04/10
cases- 2021/04/10 - 2021/04/24
deaths 2021/04/10 - 2021/04/24



https://upload.wikimedia.org/wikipedia/commons/thumb/6/69/India_states_and_union_territories_map.svg/1639px-India_states_and_union_territories_map.svg.png

12
actual epidemic charts / India
« on: April 17, 2021, 09:58:21 pm »
India updates : https://www.mohfw.gov.in/
Maharashtra dashboard : https://www.covid19maharashtragov.in/mh-covid/dashboard
-----------------------------------------

Maharashtra:3343951 ; 3407245 ; 3458996 ; 3519208 ; 3578160 ; 3639855 ;
3703584,3770707,3839338 , 3898262 , 3960359 , 4094840 , 4228836 , 4343727
4410085,4473394,4539553,4665754

63294,51751,60212,58952,61695,63729,67123,68631
58924(26.6%),62097(23.4%),134481(24.3%),133996(23.8%)
114891(22.4%),66358(23.5%),63329(23.2%),66159(23.0%)
126201(21.8%)
tests,23854185,24075811,24341736,--,24895986,25460008,
25972018,26254737,26527862,26816075,27395288
-----------------------------------------------------


Code: [Select]
daily B.1.617 at cog_uk 0405-0417:
48,--,67,69,69,76,76,
79,79,90,98,140,160,171,
187,---,226,---,---,---,---,
---,441,505,562,---,688,730

Code: [Select]
daily E484Q at cog_UK 0322-0417 :
+50%/w --> more than B.1.1.7 in 15 weeks
064,---,079,086,---,---,---,
088,---,094,098,098,---,106,
109,---,128,130,---,138,138,
142,143,154,163,171,180,184
187,---,203,---,---,---,---,
---,276,298,304,---,322,332

Code: [Select]
daily L452R at cog_UK 0322-0416 :
217,---.263,288,---,---,---,
291,---,340,348,350,---,366,
369,---,452,458,---,487,487,
497,505,536,561,582,607,618
645,---,702,---,---,---,---,
---,981,1052,1115,----,1257,1303

weekly L452R+E484Q : 4,5,14,16,21,34,44,75,51,02
weekly B.1.617 : 4,5,14,18,22,51,99,233,271,13
weekly P.1 : 2,1,3,4,6,10,8,2,11,12,19,14,0
weekly B.1.351 : 08,23,36,59,31,21,29,21,31,38,38,63,90,68,73,61,38,00
weekly B.1.525 : 5,8,15,14,12,16,21,50,55,47,48,26,26,14,21,17,0
weekly B.1.1.318 : 1,4,2,11,6,6,22,14,8,24,14,12,6,10,1
weekly B.1.1.7 : 2407,9870,12943,13300,19156,11687,14101,16452,16136,
14061,16547,16111,17087,12485,8034,7119,4533,114
updated 2021-05-02 , until week 70
-----------------------

B.1.617 / B.1.1.7 : 001,004,012,033,060,114


Code: [Select]
weeks 61,..,69 ; updated on 04-29
B.1.617  ,02,05,14,18,22,51,100,225,125
B.1.351  ,29,38,38,63,90,68,71,56,28
C.36     ,03,15,16,11,09,11,16,24,14
B.1.525  ,43,55,47,48,26,26,14,21,05
P.1      ,04,06,10,08,02,11,12,17,11
B.1.     ,36,39,51,25,27,14,14,18,08
B.1.1.   ,20,25,24,04,12,05,08,08,04
B.1.36.  ,07,04,14,07,02,01,02,07,00
A        ,14,11,08,19,37,14,17,08,03
B.1.1.318,08,24,18,11,28,14,13,06,05
B.1.177  ,167,84,66,30,28,4,11,05,00
B.1.177. ,100,43,25,11,12,4,00,01,00
B.1.36.31,02,08,25,14,05,04,01,00,01
B.1.36   ,06,11,11,07,02,01,00,00,01
B.1.1.7  ,15995,14048,16510,16109,17085,12480,7921,6925,2363

617/117  ,001,004,008,011,013,041,126,325,529, 13.2, 33.1, 82.7, 206.8



{no updates at cog-UK 2021-04-22-2021-04-26}


13
genetics / PRRA
« on: April 13, 2021, 02:22:47 am »
PRRA [nucleotides CTCCTCGGCGGG or TCCTCGGCGGGC, depending how you align ]
is the amino-acid-furin cleavage site ("FCS") inserted into SARS2 at the S1-S2 border in the spike protein.
It is not seen in the similar bat or pangolin viruses, so ir was speculated that it was
inserted in a lab , as done in similar experiments on IBV=infectious bronchitis virus,
 a coronavirus in birds, for which they are trying to create chicken-vaccines.

there are 2 such FCS in some coronaviruses :

Code: [Select]
CTCCTCGGCGGG = insertion
TCTCCTCGGCGGGCACGT , SARS2  , spike , 2038-2055
  S  P  R  R  A  R
AAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTC , SARS2,spike,2431-2469
  K  P  S  K  R  S  F  I  E  D  L  L  F
AGTCCTAGAAGGCGTTCTTTTATTGAAGACCTTCTATTT , IBV  ,spike,2056-2094,AY761141
  S  P  R  R  R  S  F  I  E  D  L  L  F 

AGTCCTAGAAGGCG
 CTCCTCGGCGGG
 x----x-xx--x


https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5413309/
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6832359/pdf/viruses-11-00972.pdf



14
genetics / Re: spike-mutations
« on: April 03, 2021, 03:14:28 am »
Code: [Select]
RBD:319-541
RBR:395-518
Bloom : 346,378,417,444,447,455f,484,490,486f     
        383f,452,419,384,475,472f
--------------------------------------------
(1) mutation in the RBD
(2) 1000*(4)/(3)
(3) number of sequences 0324 at cog-UK
(4) number of sequences 0324 at cog-UK
(5) #=match in the Bloom-picture


  (1), (2),   (3),   (4) (5)
E484K,1178,000965,001137  #

L452R,1330,000263,000350  #
F490S,1326,000202,000268  #
P384L,1308,000269,000352  #
K417N,1243,000393,000489  #
L455F,1176,000090,000106  #
S477R,1149,000113,000130
P384S,1148,000241,000277  #
T385N,1122,000212,000238

K458N,3223,000012,000039
Y449H,2624,000014,000037
Y449D,1900,000012,000023
G496S,1464,000032,000047
A372V,1390,000015,000021
K417T,1365,000027,000037  #
F490Y,1304,000016,000021  #
K529R,1286,000031,000040
N370H,1277,000032,000041
R346S,1270,000018,000023  #
L335F,1258,000042,000053 
E484Q,1238,000079,000098  #
Q321R,1232,000021,000026
E324K,1187,000026,000031
P322S,1183,000032,000038
Q493K,1160,000018,000021
K444N,1160,000018,000021  #
V483F,1155,000070,000081


15
genetics / table/overview of new variants
« on: March 28, 2021, 11:46:29 pm »

at cog-uk :

Code: [Select]
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K
--------------------------------------------------------------------------------------------------
0202,224821, 42108, 132,  0,  36,73752, 876,3723,764,  1,  0,  0,  0,21,238
0214,257783, 67110, 197, 20,  36,77610, 880,3805,777,  1,  0,  0,  0,33,384
0228,297806,101496, 256, 44,  37,79650, 885,3845,783,  1, 17,  0,  5,42,532
0312,322718,124919, 295, 47,  37,80336, 880,3859,787,  1, 54,  1, 14,51,661
0327,358209,157497, 363, 51,  41,80721, 882,3881,791,  1,174,  6, 33,56,985
-----------------------------------------------------------------------------------------------------------
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K



at GISAID :

Code: [Select]
----------------P.1  -----------------------------
00003,00009 , 00000,00009 , 00034,02220 , 00087,02136 , 00181,03633 , Italy
00000,00000 , 00000,00000 , 00017,01697 , 00018,00934 , 00051,01672 , Belgium
00030,00115 , 00044,00101 , 00195,00399 , 00039,00269 , 00099,00351 , Brazil
00001,02564 , 00002,02406 , 00007,30072 , 00013,18305 , 00027,33146 , United States Of America
00000,00000 , 00000,00000 , 00014,01818 , 00003,01640 , 00004,01034 , Switzerland
00000,00000 , 00003,00082 , 00005,01724 , 00001,01365 , 00005,02909 , France
00000,00000 , 00002,00074 , 00002,02238 , 00000,00952 , 00008,02160 , Netherlands
00000,00000 , 00000,00000 , 00009,00073 , 00004,00006 , 00009,00034 , Colombia
00000,00000 , 00000,00000 , 00001,00132 , 00000,00101 , 00002,01101 , Mexico
00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , Faroe Islands
00004,00004 , 00000,00002 , 00002,00037 , 00000,02089 , 00000,00021 , Japan
00000,00000 , 00000,00000 , 00001,00588 , 00000,00431 , 00004,02185 , Spain
00000,00000 , 00000,00000 , 00000,00000 , 00006,03614 , 00001,01474 , Sweden
00000,00000 , 00000,00000 , 00000,00000 , 00001,00030 , 00001,00068 , Australia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00003,00025 , New Zealand
00000,00000 , 00000,00000 , 00002,02603 , 00002,20869 , 00018,33844 , United Kingdom
00000,00000 , 00000,00000 , 00002,00007 , 00003,00633 , 00002,00006 , Portugal
00000,00000 , 00000,00000 , 00001,00383 , 00005,01485 , 00002,00604 , Ireland
00000,00000 , 00000,00000 , 00000,00000 , 00014,06508 , 00019,10631 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00155 , Chile
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00603 , Norway
00000,00000 , 00000,00000 , 00000,00000 , 00002,00018 , 00000,00054 , Romania
00001,00001 , 00000,00000 , 00000,00172 , 00000,00146 , 00000,00322 , South Korea
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00843 , Slovenia
00000,00000 , 00001,00001 , 00000,00000 , 00022,00167 , 00000,00000 , Peru
00000,00000 , 00000,00000 , 00002,00452 , 00000,00885 , 00001,00778 , Turkey
00040,02694 , 00052,02675 , 00294,44615 , 00220,62583 , 00445,97653 , all
--------------------------------------------------------------------------------
        1.5 ,         1.9 ,         0.7 ,         0.4 ,         0.5 , all
       3877 ,        3108 ,        2239 ,        2904 .        3555 , all-Brazil
       0201          0209          0301          0312          0326 , date



from https://cov-lineages.org/global_report_P.1.html


Code: [Select]
---------------B.1.351l--------------------------------------------------------
00007,00007 , 00030,00038 , 00009,00011 , 00000,00000 , 00007,00007 , Botswana
00000,00000 , 00002,00018 , 00035,00620 , 00024,00885 , 00028,00778 , Turkey
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00002,03063 , 00006,06078 , 00014,36159 , 00030,19511 , 00095,33718 , United States Of America
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00519,00891 , 00216,00317 , 00303,00384 , 00048,00060 , 00336,00390 , South Africa
00003,06443 , 00004,06313 , 00003,04497 , 00002,02402 , 00000,00000 , Denmark
00094,51301 , 00038,26746 , 00053,37892 , 00029,22208 , 00090,35908 , United Kingdom
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00007,00068 , 00020,00024 , 00269,00427 , 00051,00137 , 00006,00015 , Mayotte
00009,00321 , 00001,00382 , 00000,00944 , 00009,01518 , 00004,00620 , Ireland
00000,00000 , 00001,00385 , 00001,00344 , 00000,00032 , 00000,00278 , Canada
00019,00052 , 00022,00031 , 00000,00000 , 00017,00027 , 00000,00000 , Mozambique
00000,00000 , 00001,00003 , 00000,00000 , 00000,00000 , 00000,00000 , Democratic Republic Of The Congo
00008,00392 , 00008,00054 , 00004,00064 , 00003,00056 , 00008,00080 , Australia
00000,00000 , 00000,00000 , 00001,00027 , 00012,03455 , 00000,00027 , Japan
00001,00009 , 00000,00000 , 00003,00257 , 00000,00147 , 00001,00335 , South Korea
00000,00000 , 00000,00000 , 00003,00048 , 00000,00035 , 00001,00004 , Thailand
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00002,00006 , 00004,00079 , 00000,00003 , 00000,00000 , 00000,00000 , Kenya
00005,00063 , 00000,00000 , 00000,00001 , 00000,00000 , 00000,00000 , United Arab Emirates
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00001,00041 , 00000,00534 , 00001,00056 , 00008,01161 , 00002,00007 , Portugal
00000,00000 , 00031,00033 , 00000,00000 , 00000,00000 , 00000,00000 , Zambia
00007,00048 , 00000,00000 , 00012,00054 , 00000,00010 , 00001,00035 , New Zealand
00000,00000 , 00000,00000 , 00000,00000 , 00002,00195 , 00004,00277 , Croatia
00000,00000 , 00000,00000 , 00001,00050 , 00005,00021 , 00007,00031 , Singapore
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00000,00000 , 00000,00000 , 00001,00023 , 00000,00000 , 00010,00068 , Rwanda
00000,00000 , 00000,00000 , 00001,00001 , 00001,00006 , 00000,00000 , Costa Rica
00000,00000 , 00007,00392 , 00009,00441 , 00000,00000 , 00036,01794 , Israel
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00063 , Aruba
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00005 , Sri Lanka
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00001,00003 , 00000,00000 , Brunei
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , Guadeloupe
00000,00000 , 00001,00078 , 00003,00017 , 00000,00000 , 00000,00065 , Ghana
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
00000,00000 , 00000,00000 , 00000,00000 , 00001,00015 , 00000,00000 , Cameroon
00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , 00000,00000 , Reunion
00000,00000 , 00000,00000 , 00000,00000 , 00195,00264 , 00004,00017 , Zimbabwe
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00002 , Russia
00000,00000 , 00001,00009 , 00000,00004 , 00000,00000 , 00000,00000 , Bangladesh
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00020,00021 , Eswatini
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00042 , China
00000,00000 , 00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , Panama
00000,00000 , 00002,00048 , 00000,00000 , 00000,00000 , 00000,00000 , Luxembourg
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00014,00015 , Lesotho
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00004,00018 , Malaysia
00750,69594 , 00485,46120 , 01066,98949 , 01013,82284 , 01488,108170, all
        1.1 ,         1.1 ,         1.1 ,         1.2 ,         1.4
       3362 ,        5872 ,        7741 ,       11678 ,       10706 
00086,13762 , 00116,11858 , 00613,22549 , 00646,35548 , 00822,34478 , Europe
       6249 ,        9782 ,       27185 ,       18173 ,       23841
-------------------------------------------------------------------------------
       0201          0214          0301          0312          0326



Code: [Select]
-------------------B.1.1.7 ---------------------------------
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
--------------------------------------------------------------------------------------

Germany,2021-03-01,142,1544
Germany,2021-03-08,4424,14533
Germany,2021-03-13,7389,20150
Germany,2021-03-21,10109,25376
Germany,2021-03-26,10115,25410

2021-03-01, 142/ 1544=09%
2021-03-08,4282/12989=33%
2021-03-13,2965/ 5587=53%
2021-03-29,2726/ 5260=52%



Pages: [1] 2 3 ... 14