Recent Posts

Pages: 1 [2] 3 4 ... 10
11
actual epidemic charts / Re: India
« Last post by gsgs on April 25, 2021, 02:07:47 am »
https://whitenewspaper.com/2021/04/24/nearly-60-of-samples-of-indian-variant-from-maha-find-scientists-health-news-et-healthworld/
2021-04-24
both Covaxin and Covishield are able to protect against the strain, reports Sumitra Deb Roy.

all: 15133  (during which time ?)
B.1.1.7 = 1195 (543Punjab, 124Delhi , 29Maha
B.1.617 = 728 (427Maha, 124WB, 75 Delhi , 53Mp)
B.1.351 = 29

----------------------------------------------------------------------------------
Mumbai, peek on 2021-04-04 = 11206 cases
now 5867 cases

---------------------------------------------------------------------

Code: [Select]
Laksha, 7026 ,  0 ,18271 ,  0
Delhi-, 4046 , 17 ,17766 ,160
Goa---, 4434 , 37 , 9560 ,101
Ladakh, 2937 ,  0 , 9554 , 21
Chhatt, 4179 , 32 , 8652 , 96
Mahara,10311 , 47 , 8367 , 58
Chandi, 7914 , 39 , 7579 , 37
Puduch, 3035 , 16 , 7056 , 40
Kerala, 3152 , 17 , 6680 ,  9
DadraN,  817 ,  0 , 4259 ,  3
Karnat, 1611 ,  8 , 4195 , 24
Uttara,  913 ,  5 , 4083 , 34
Haryan, 1587 ,  7 , 4056 , 18
Total#, 1769 ,  9 , 3101 , 19
Himach, 1409 , 15 , 2617 , 29
Gujara, 1132 ,  4 , 2394 , 24
Punjab, 3103 , 57 , 2365 , 34
Madhya,  916 ,  3 , 2182 , 12
Rajast,  501 ,  1 , 2105 ,  9
Andhra,  585 ,  2 , 2064 ,  6
Teleng,  732 ,  3 , 2032 ,  7
TamilN,  980 ,  5 , 2016 ,  8
UttarP,  304 ,  1 , 1938 ,  9
Jharkh,  452 ,  2 , 1853 , 21
JammuK,  837 ,  5 , 1785 ,  8
Sikkim,  321 ,  1 , 1357 ,  1
WestBe,  350 ,  1 , 1332 ,  5
Odisha,  235 ,  0 , 1299 ,  1
Andama,  380 ,  0 , 1190 , 10
Bihar-,  130 ,  0 , 1102 ,  4
Mizora,  149 ,  0 ,  733 ,  1
Meghal,   82 ,  1 ,  532 ,  2
Assam-,   66 ,  0 ,  517 ,  2
Arunac,   28 ,  0 ,  484 ,  0
Manipu,   86 ,  0 ,  313 ,  3
Nagala,   96 ,  0 ,  310 ,  1
Tripur,   75 ,  0 ,  229 ,  0

-------------------------------------

India , COVID 19 by state , per million population
cases- 2021/03/10 - 2021/04/10
deaths 2021/03/10 - 2021/04/10
cases- 2021/04/10 - 2021/04/24
deaths 2021/04/10 - 2021/04/24



https://upload.wikimedia.org/wikipedia/commons/thumb/6/69/India_states_and_union_territories_map.svg/1639px-India_states_and_union_territories_map.svg.png
12
actual epidemic charts / India
« Last post by gsgs on April 17, 2021, 09:58:21 pm »
India updates : https://www.mohfw.gov.in/
Maharashtra dashboard : https://www.covid19maharashtragov.in/mh-covid/dashboard
-----------------------------------------

Maharashtra:3343951 ; 3407245 ; 3458996 ; 3519208 ; 3578160 ; 3639855 ;
3703584,3770707,3839338 , 3898262 , 3960359 , 4094840 , 4228836 , 4343727
4410085,4473394,4539553,4665754

63294,51751,60212,58952,61695,63729,67123,68631
58924(26.6%),62097(23.4%),134481(24.3%),133996(23.8%)
114891(22.4%),66358(23.5%),63329(23.2%),66159(23.0%)
126201(21.8%)
tests,23854185,24075811,24341736,--,24895986,25460008,
25972018,26254737,26527862,26816075,27395288
-----------------------------------------------------


Code: [Select]
daily B.1.617 at cog_uk 0405-0417:
48,--,67,69,69,76,76,
79,79,90,98,140,160,171,
187,---,226,---,---,---,---,
---,441,505,562,---,688,730

Code: [Select]
daily E484Q at cog_UK 0322-0417 :
+50%/w --> more than B.1.1.7 in 15 weeks
064,---,079,086,---,---,---,
088,---,094,098,098,---,106,
109,---,128,130,---,138,138,
142,143,154,163,171,180,184
187,---,203,---,---,---,---,
---,276,298,304,---,322,332

Code: [Select]
daily L452R at cog_UK 0322-0416 :
217,---.263,288,---,---,---,
291,---,340,348,350,---,366,
369,---,452,458,---,487,487,
497,505,536,561,582,607,618
645,---,702,---,---,---,---,
---,981,1052,1115,----,1257,1303

weekly L452R+E484Q : 4,5,14,16,21,34,44,75,51,02
weekly B.1.617 : 4,5,14,18,22,51,99,233,271,13
weekly P.1 : 2,1,3,4,6,10,8,2,11,12,19,14,0
weekly B.1.351 : 08,23,36,59,31,21,29,21,31,38,38,63,90,68,73,61,38,00
weekly B.1.525 : 5,8,15,14,12,16,21,50,55,47,48,26,26,14,21,17,0
weekly B.1.1.318 : 1,4,2,11,6,6,22,14,8,24,14,12,6,10,1
weekly B.1.1.7 : 2407,9870,12943,13300,19156,11687,14101,16452,16136,
14061,16547,16111,17087,12485,8034,7119,4533,114
updated 2021-05-02 , until week 70
-----------------------

B.1.617 / B.1.1.7 : 001,004,012,033,060,114


Code: [Select]
weeks 61,..,69 ; updated on 04-29
B.1.617  ,02,05,14,18,22,51,100,225,125
B.1.351  ,29,38,38,63,90,68,71,56,28
C.36     ,03,15,16,11,09,11,16,24,14
B.1.525  ,43,55,47,48,26,26,14,21,05
P.1      ,04,06,10,08,02,11,12,17,11
B.1.     ,36,39,51,25,27,14,14,18,08
B.1.1.   ,20,25,24,04,12,05,08,08,04
B.1.36.  ,07,04,14,07,02,01,02,07,00
A        ,14,11,08,19,37,14,17,08,03
B.1.1.318,08,24,18,11,28,14,13,06,05
B.1.177  ,167,84,66,30,28,4,11,05,00
B.1.177. ,100,43,25,11,12,4,00,01,00
B.1.36.31,02,08,25,14,05,04,01,00,01
B.1.36   ,06,11,11,07,02,01,00,00,01
B.1.1.7  ,15995,14048,16510,16109,17085,12480,7921,6925,2363

617/117  ,001,004,008,011,013,041,126,325,529, 13.2, 33.1, 82.7, 206.8



{no updates at cog-UK 2021-04-22-2021-04-26}

13
genetics / PRRA
« Last post by gsgs on April 13, 2021, 02:22:47 am »
PRRA [nucleotides CTCCTCGGCGGG or TCCTCGGCGGGC, depending how you align ]
is the amino-acid-furin cleavage site ("FCS") inserted into SARS2 at the S1-S2 border in the spike protein.
It is not seen in the similar bat or pangolin viruses, so ir was speculated that it was
inserted in a lab , as done in similar experiments on IBV=infectious bronchitis virus,
 a coronavirus in birds, for which they are trying to create chicken-vaccines.

there are 2 such FCS in some coronaviruses :

Code: [Select]
CTCCTCGGCGGG = insertion
TCTCCTCGGCGGGCACGT , SARS2  , spike , 2038-2055
  S  P  R  R  A  R
AAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTC , SARS2,spike,2431-2469
  K  P  S  K  R  S  F  I  E  D  L  L  F
AGTCCTAGAAGGCGTTCTTTTATTGAAGACCTTCTATTT , IBV  ,spike,2056-2094,AY761141
  S  P  R  R  R  S  F  I  E  D  L  L  F 

AGTCCTAGAAGGCG
 CTCCTCGGCGGG
 x----x-xx--x


https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5413309/
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6832359/pdf/viruses-11-00972.pdf


14
genetics / Re: spike-mutations
« Last post by gsgs on April 03, 2021, 03:14:28 am »
Code: [Select]
RBD:319-541
RBR:395-518
Bloom : 346,378,417,444,447,455f,484,490,486f     
        383f,452,419,384,475,472f
--------------------------------------------
(1) mutation in the RBD
(2) 1000*(4)/(3)
(3) number of sequences 0324 at cog-UK
(4) number of sequences 0324 at cog-UK
(5) #=match in the Bloom-picture


  (1), (2),   (3),   (4) (5)
E484K,1178,000965,001137  #

L452R,1330,000263,000350  #
F490S,1326,000202,000268  #
P384L,1308,000269,000352  #
K417N,1243,000393,000489  #
L455F,1176,000090,000106  #
S477R,1149,000113,000130
P384S,1148,000241,000277  #
T385N,1122,000212,000238

K458N,3223,000012,000039
Y449H,2624,000014,000037
Y449D,1900,000012,000023
G496S,1464,000032,000047
A372V,1390,000015,000021
K417T,1365,000027,000037  #
F490Y,1304,000016,000021  #
K529R,1286,000031,000040
N370H,1277,000032,000041
R346S,1270,000018,000023  #
L335F,1258,000042,000053 
E484Q,1238,000079,000098  #
Q321R,1232,000021,000026
E324K,1187,000026,000031
P322S,1183,000032,000038
Q493K,1160,000018,000021
K444N,1160,000018,000021  #
V483F,1155,000070,000081

15
genetics / table/overview of new variants
« Last post by gsgs on March 28, 2021, 11:46:29 pm »

at cog-uk :

Code: [Select]
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K
--------------------------------------------------------------------------------------------------
0202,224821, 42108, 132,  0,  36,73752, 876,3723,764,  1,  0,  0,  0,21,238
0214,257783, 67110, 197, 20,  36,77610, 880,3805,777,  1,  0,  0,  0,33,384
0228,297806,101496, 256, 44,  37,79650, 885,3845,783,  1, 17,  0,  5,42,532
0312,322718,124919, 295, 47,  37,80336, 880,3859,787,  1, 54,  1, 14,51,661
0327,358209,157497, 363, 51,  41,80721, 882,3881,791,  1,174,  6, 33,56,985
-----------------------------------------------------------------------------------------------------------
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K



at GISAID :

Code: [Select]
----------------P.1  -----------------------------
00003,00009 , 00000,00009 , 00034,02220 , 00087,02136 , 00181,03633 , Italy
00000,00000 , 00000,00000 , 00017,01697 , 00018,00934 , 00051,01672 , Belgium
00030,00115 , 00044,00101 , 00195,00399 , 00039,00269 , 00099,00351 , Brazil
00001,02564 , 00002,02406 , 00007,30072 , 00013,18305 , 00027,33146 , United States Of America
00000,00000 , 00000,00000 , 00014,01818 , 00003,01640 , 00004,01034 , Switzerland
00000,00000 , 00003,00082 , 00005,01724 , 00001,01365 , 00005,02909 , France
00000,00000 , 00002,00074 , 00002,02238 , 00000,00952 , 00008,02160 , Netherlands
00000,00000 , 00000,00000 , 00009,00073 , 00004,00006 , 00009,00034 , Colombia
00000,00000 , 00000,00000 , 00001,00132 , 00000,00101 , 00002,01101 , Mexico
00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , Faroe Islands
00004,00004 , 00000,00002 , 00002,00037 , 00000,02089 , 00000,00021 , Japan
00000,00000 , 00000,00000 , 00001,00588 , 00000,00431 , 00004,02185 , Spain
00000,00000 , 00000,00000 , 00000,00000 , 00006,03614 , 00001,01474 , Sweden
00000,00000 , 00000,00000 , 00000,00000 , 00001,00030 , 00001,00068 , Australia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00003,00025 , New Zealand
00000,00000 , 00000,00000 , 00002,02603 , 00002,20869 , 00018,33844 , United Kingdom
00000,00000 , 00000,00000 , 00002,00007 , 00003,00633 , 00002,00006 , Portugal
00000,00000 , 00000,00000 , 00001,00383 , 00005,01485 , 00002,00604 , Ireland
00000,00000 , 00000,00000 , 00000,00000 , 00014,06508 , 00019,10631 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00155 , Chile
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00603 , Norway
00000,00000 , 00000,00000 , 00000,00000 , 00002,00018 , 00000,00054 , Romania
00001,00001 , 00000,00000 , 00000,00172 , 00000,00146 , 00000,00322 , South Korea
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00843 , Slovenia
00000,00000 , 00001,00001 , 00000,00000 , 00022,00167 , 00000,00000 , Peru
00000,00000 , 00000,00000 , 00002,00452 , 00000,00885 , 00001,00778 , Turkey
00040,02694 , 00052,02675 , 00294,44615 , 00220,62583 , 00445,97653 , all
--------------------------------------------------------------------------------
        1.5 ,         1.9 ,         0.7 ,         0.4 ,         0.5 , all
       3877 ,        3108 ,        2239 ,        2904 .        3555 , all-Brazil
       0201          0209          0301          0312          0326 , date



from https://cov-lineages.org/global_report_P.1.html


Code: [Select]
---------------B.1.351l--------------------------------------------------------
00007,00007 , 00030,00038 , 00009,00011 , 00000,00000 , 00007,00007 , Botswana
00000,00000 , 00002,00018 , 00035,00620 , 00024,00885 , 00028,00778 , Turkey
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00002,03063 , 00006,06078 , 00014,36159 , 00030,19511 , 00095,33718 , United States Of America
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00519,00891 , 00216,00317 , 00303,00384 , 00048,00060 , 00336,00390 , South Africa
00003,06443 , 00004,06313 , 00003,04497 , 00002,02402 , 00000,00000 , Denmark
00094,51301 , 00038,26746 , 00053,37892 , 00029,22208 , 00090,35908 , United Kingdom
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00007,00068 , 00020,00024 , 00269,00427 , 00051,00137 , 00006,00015 , Mayotte
00009,00321 , 00001,00382 , 00000,00944 , 00009,01518 , 00004,00620 , Ireland
00000,00000 , 00001,00385 , 00001,00344 , 00000,00032 , 00000,00278 , Canada
00019,00052 , 00022,00031 , 00000,00000 , 00017,00027 , 00000,00000 , Mozambique
00000,00000 , 00001,00003 , 00000,00000 , 00000,00000 , 00000,00000 , Democratic Republic Of The Congo
00008,00392 , 00008,00054 , 00004,00064 , 00003,00056 , 00008,00080 , Australia
00000,00000 , 00000,00000 , 00001,00027 , 00012,03455 , 00000,00027 , Japan
00001,00009 , 00000,00000 , 00003,00257 , 00000,00147 , 00001,00335 , South Korea
00000,00000 , 00000,00000 , 00003,00048 , 00000,00035 , 00001,00004 , Thailand
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00002,00006 , 00004,00079 , 00000,00003 , 00000,00000 , 00000,00000 , Kenya
00005,00063 , 00000,00000 , 00000,00001 , 00000,00000 , 00000,00000 , United Arab Emirates
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00001,00041 , 00000,00534 , 00001,00056 , 00008,01161 , 00002,00007 , Portugal
00000,00000 , 00031,00033 , 00000,00000 , 00000,00000 , 00000,00000 , Zambia
00007,00048 , 00000,00000 , 00012,00054 , 00000,00010 , 00001,00035 , New Zealand
00000,00000 , 00000,00000 , 00000,00000 , 00002,00195 , 00004,00277 , Croatia
00000,00000 , 00000,00000 , 00001,00050 , 00005,00021 , 00007,00031 , Singapore
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00000,00000 , 00000,00000 , 00001,00023 , 00000,00000 , 00010,00068 , Rwanda
00000,00000 , 00000,00000 , 00001,00001 , 00001,00006 , 00000,00000 , Costa Rica
00000,00000 , 00007,00392 , 00009,00441 , 00000,00000 , 00036,01794 , Israel
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00063 , Aruba
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00005 , Sri Lanka
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00001,00003 , 00000,00000 , Brunei
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , Guadeloupe
00000,00000 , 00001,00078 , 00003,00017 , 00000,00000 , 00000,00065 , Ghana
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
00000,00000 , 00000,00000 , 00000,00000 , 00001,00015 , 00000,00000 , Cameroon
00000,00000 , 00000,00000 , 00000,00000 , 00001,00001 , 00000,00000 , Reunion
00000,00000 , 00000,00000 , 00000,00000 , 00195,00264 , 00004,00017 , Zimbabwe
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00002 , Russia
00000,00000 , 00001,00009 , 00000,00004 , 00000,00000 , 00000,00000 , Bangladesh
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00020,00021 , Eswatini
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00042 , China
00000,00000 , 00001,00001 , 00000,00000 , 00000,00000 , 00000,00000 , Panama
00000,00000 , 00002,00048 , 00000,00000 , 00000,00000 , 00000,00000 , Luxembourg
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00014,00015 , Lesotho
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00004,00018 , Malaysia
00750,69594 , 00485,46120 , 01066,98949 , 01013,82284 , 01488,108170, all
        1.1 ,         1.1 ,         1.1 ,         1.2 ,         1.4
       3362 ,        5872 ,        7741 ,       11678 ,       10706 
00086,13762 , 00116,11858 , 00613,22549 , 00646,35548 , 00822,34478 , Europe
       6249 ,        9782 ,       27185 ,       18173 ,       23841
-------------------------------------------------------------------------------
       0201          0214          0301          0312          0326



Code: [Select]
-------------------B.1.1.7 ---------------------------------
00008,00667 , 00047,01150 , 00120,02164 , 00097,01001 , 00149,01724 , Belgium
00001,00065 , 00000,00143 , 00006,00191 , 00040,00794 , 00088,02003 , Norway
00001,00366 , 00001,00704 , 00005,01416 , 00003,00880 , 00007,02789 , Spain
00011,00548 , 00020,00908 , 00085,01712 , 00056,01484 , 00173,03102 , France
00000,00000 , 00000,00000 , 00003,01930 , 00006,02081 , 00004,03201 , Italy
00000,00000 , 00000,00000 , 00001,00001 , 00001,00084 , 00018,02233 , Slovenia
00010,03016 , 00011,00512 , 00040,05127 , 00020,03982 , 00013,02355 , Switzerland
00022,01660 , 00009,00679 , 00056,02468 , 00012,01284 , 00116,02558 , Netherlands
00000,00000 , 00001,00027 , 00013,00100 , 00148,00937 , 00003,00040 , Austria
00001,00075 , 00000,00187 , 00004,00701 , 00058,04393 , 00044,01584 , Sweden
00010,00382 , 00000,00247 , 00003,00362 , 00131,12915 , 00179,10737 , Germany
00000,00000 , 00000,00000 , 00000,00000 , 00002,00300 , 00001,00501 , Poland
00002,00110 , 00000,00000 , 00004,00453 , 00000,00000 , 00000,00276 , Finland
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00006,00192 , Slovakia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00135 , Estonia
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00001,00070 , Czech Republic
00000,00000 , 00000,00000 , 00000,00000 , 00000,00000 , 00002,00059 , Lithuania
--------------------------------------------------------------------------------------

Germany,2021-03-01,142,1544
Germany,2021-03-08,4424,14533
Germany,2021-03-13,7389,20150
Germany,2021-03-21,10109,25376
Germany,2021-03-26,10115,25410

2021-03-01, 142/ 1544=09%
2021-03-08,4282/12989=33%
2021-03-13,2965/ 5587=53%
2021-03-29,2726/ 5260=52%


16
genetics / Re: B.1.1.7 (UK) and B.1.351(SA) and P1(Manaos) and 22033 ...)
« Last post by gsgs on March 28, 2021, 11:43:12 pm »
Code: [Select]
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K
--------------------------------------------------------------------------------------------------
0202,224821, 42108, 132,  0,  36,73752, 876,3723,764,  1,  0,  0,  0,21,238
0214,257783, 67110, 197, 20,  36,77610, 880,3805,777,  1,  0,  0,  0,33,384
0228,297806,101496, 256, 44,  37,79650, 885,3845,783,  1, 17,  0,  5,42,532
0312,322718,124919, 295, 47,  37,80336, 880,3859,787,  1, 54,  1, 14,51,661
0327,358209,157497, 363, 51,  41,80721, 882,3881,791,  1,174,  6, 33,56,985
-----------------------------------------------------------------------------------------------------------
date,   all,   1.7, 351,A23,1.28,  177,1.70, 258,221,375,525,526, P1,P2,E484K


===============================================================

weeks 61,...,69 , from cog_0427.lw1

Code: [Select]

B.1.351  , 29,38,38,63,90,68,71,54,09
B.1.617  , 02,05,14,18,21,50,91,198,42
B.1.525  , 43,56,45,48,27,26,13,18,03
B.1.1.318, 08,24,18,11,27,14,13,04,01
A        , 13,10,08,19,43,14,18,09,03
C.36     , 03,15,16,11,09,11,14,24,03
P.1      , 04,06,10,08,02,11,11,17,05
B.1.36.31, 02,08,25,14,05,04,01,00,00
B.1.177. ,105,46,27,13,12,04,00,01,00
B.1.177  ,162,84,69,28,28,04,11,05,00
B.1.36.  , 07,04,15,07,02,01,01,08,00
B.1.36   , 06,11,11,07,02,01,00,00,00
B.1.1.   , 19,24,23,04,13,03,08,06,01
B.1.     , 37,35,48,22,19,16,13,16,05
B.1.1.7,15991,13973,16496,16091,17073,12456,7619,6553,742


17
genetics / Re: B.1.1.7 (UK) and B.1.351(SA) and P1(Manaos) and 22033 ...)
« Last post by gsgs on March 25, 2021, 03:41:20 am »
Code: [Select]
>B.1.1.7 ,28,C00241T,C00913T,C03037T,C03267T,C05388A,C05986T,T06954C,C14408T,C14676T,C15279T,T16176C,A23063T,C23271A,A23403G,C23604A,C23709T,T24506G,G24914C,C27972T,G28048T,A28111G,G28280C,A28281T,T28282A,G28881A,G28882A,G28883C,C28977T
>B.1.351 ,19,C00241T,C01059T,A02692T,C03037T,G05230T,A10323G,C14408T,A21801C,A22206G,G22813T,G23012A,A23063T,A23403G,C23664T,G25563T,C25904T,C26456T,C28253T,C28887T
>A.23    ,22,A00901T,C04573T,C08782T,C10747T,G11230T,G11266T,G11521T,C16575T,C17745T,G21985T,C22000T,C22033A,G22661T,G23401T,C23604G,T24097C,C25708T,G28079T,T28144C,G28167A,G28378C,G28878A
>B.1.1.28,25,C00241T,T00733C,C03037T,A05648C,A06319G,A06613G,C14408T,G17259T,C21614T,C21621A,C21638T,G21974T,A22812C,G23012A,A23403G,C24642T,G25088T,T26149C,G28167A,C28512G,A28877T,G28878C,G28881A,G28882A,G28883C
>B.1.177 ,13,C00241T,T00445C,C03037T,C06286T,C14408T,G21255C,C21614T,C22227T,A23403G,C26801G,C27944T,C28932T,G29645T
>B.1.1.70,25,C00214T,C03037T,C03096T,G04255A,C07334T,G10265A,C10449T,A12103G,C14408T,A15972G,C19374T,C19718T,C20270T,G20433A,A23063T,A23403G,A25859G,T26504C,C26858T,C27434T,G28300C,T28759C,G28881A,G28882A,G28883C
>B.1.258 , 6,T07767C,C08047T,C17104T,A20268G,C22879A,G29734C
>B.1.221 ,13,C00241T,C03037T,C03602T,C06941T,C14408T,C15324T,C21855T,A23403G,A25505G,G25906C,G25996T,C28651T,C28869T
>B.1.375 ,14,C00241T,C03037T,A23403G,C14408T,C01059T,T01171C,A05747G,C10789T,G17259T,G24007A,G25563T,C25844T,A26664G,C28887T
>B.1.525 ,18,C01498T,A01807G,T08593C,C09565T,9-11288,C14407T,C18171T,A20724G,A21717G,G23012A,G23593C,T24224C,C24748T,C26305T,T26767C,3-28278,A28699G,G29543T
>B.1.526 ,15,C00241T,C01059T,C03037T,T09867C,9-11288,C14408T,A16500C,C21575T,C21846T,A22320G,A23403G,C25517T,G25563T,C28869T,G28975A
>P.1     ,31,G28883C,G28882A,G28881A,G21974T,C14408T,C03037T,A23403G,C21614T,T26149C,T00733C,G28878C,G28167A,G25088T,G23012A,G22132T,G17259T,C28512G,C24642T,C23525T,C21638T,C21621A,C13860T,C12778T,C02749T,A28877T,A23063T,A22812C,A06613G,A06319G,A05648C,C03828T




Code: [Select]

===================UK=================================
     0,  0,  0, 0,    0,  0,   0,  5, ,   , ,  ,  , 42102,2020-10-18
    66,  0,  0, 0,26660,230,2021,520, ,   , ,  ,  ,107132,2010-11-23
   963,  0,  0, 0,43679,353,2697,647, ,   , ,  ,  ,131386,2020-12-07
  3092,  1,  3, 0,49129,465,2912,650, ,   , ,  ,  ,133277,2020-12-22
  5575,  1, 11, 0,56531,539,3088,668, ,   , ,  ,  ,142672,2021-01-03
  9418, 29, 26, 0,60484,560,3326,688, ,   , ,  ,  ,151280,2021-01-08
 42130,132, 94, 0,74966,619,3818,779,1,   , ,  ,  ,201894,2021-02-03
 60543,170,129, 0,81227,656,4136,839,1, 28, ,  ,  ,242925,2021-02-09
101496,256, 44,37,79650,885,3845,703,1, 17,0, 5,42,297806,2021-02-28-
139044,324,167,10,80844,625,3904,796,1,149,3,15,53,306229,2021-03-18
162568,380,167,51,80322,770,3891,804,1,240,8,27,55,329268,2021-03-24
--------------------------------------------------------------------
     A,  B,  C, D,    E,  F,   G,  H,I,  J,K, L, M,     N,     O

A , B.1.1.7,SE-England
B , B.1.351,South Africa
C , A.23,Uganda
D , B.1.1.28,Brazil-Manaos  1176
E , B.1.177,Spain-Aragon
F , B.1.1.70,Wales
G , B.1.258 , Ireland ?
H , B.1.221 , Belgium
I , B.1.375 , USA - S-drop-out   477
J , B.1.525 , 52,67,484,677,888
K , B.1.526 ,  5,95,253,701
L , P.1     , 18,20,26,138,190,417,484,N501,655,1176,1027
M , P.2     , 484,859,1176
N , -,all,World
O , date


Code: [Select]
=============Germany===============
00,0,0,0,013,0, 4 , 0, 505,4,2010-10-18
00,0,0,0,030,0,12 , 2, 572,6,2020-11-01
00,0,0,0,076,0,32 ,11, 710,a,2020-12-07
00,0,0,0,084,0,35 ,11, 745,b,2020-12-15
00,0,0,0,092,0,37 ,15, 764,c,2020-12-18
00,0,0,0,117,0,57 ,16, 835,d,2020-12-21
00,0,0,0,137,0,62 ,16, 915,e,2020-12-30
03,0,0,0,145,1,65 ,22, 992,f,2021-01-13
05,1,0,0,188,2,71 ,26,1042,g,2021-01-16
08,1,0,0,247,2,75 ,29,1127,h,2021-01-20
14,4,0,0,288,2,79 ,38,1210,i,2021-01-25
49,4,0,0,308,2,82 ,39,1273,j,2021-01-25
59,5,0,0,352,2,97 ,46,1356,k,2021-02-01
66,5,0,0,372,2,101,50,1397,l,2021-02-03
--------------------------------------
 A,B,C,D,  E,F, G , H,   I,J,    K

A , B.1.1.7,SE-England
B , B.1.351,South Africa
C , A.23,Uganda
D , B.1.1.28,Brazil-Manaos
E , B.1.177,Spain-Aragon
F , B.1.1.70,Wales
G , B.1.258 , Ireland ?
H , B.1.221 , Belgium
I , -,all,World
J , filename
K , date

18
genetics / Re: B.1.1.7 (UK) and B.1.351(SA) and P1(Manaos) and 22033 ...)
« Last post by gsgs on February 20, 2021, 04:46:41 am »
Feb20 , % sequences with N501Y:
UK:53,DK:22,US:08,CH:20,NL:27,F:53,E:26,B:35,ICE:15,LUX:20,
I:69,IRE:79,DE:13,POR:33,SW:42,AUT:27,N:26,SA:37,
LIT:00,AUS:60,ISR:27,FIN:38,CZ:25,CDN:56,
TUR:03,POL:11,HUN:99,IND:33,BRA:00:,SLK:79
EGY:03,NIG:68,MAC:00,SGP:18,GHA:46,ARU:49
https://covariants.org/per-country
20
hi babar.
Thanks !
I could download and unzip that file.
https://storage.googleapis.com/ve-public/v1.5/data_package.json.gz
231MB , 341354 lines ,
https://storage.googleapis.com/ve-public/v1.6/data_package.json.gz
https://storage.googleapis.com/ve-public/v1.7/data_package.json.gz

.
396 with B.1.351

shall we use (part of) this forum to exchange sequencing info ?
or make another forum ?
shall I make you admin for re-organisation ?
shall we invite others ?

Pages: 1 [2] 3 4 ... 10